Incidental Mutation 'R2324:Ints3'
ID244834
Institutional Source Beutler Lab
Gene Symbol Ints3
Ensembl Gene ENSMUSG00000027933
Gene Nameintegrator complex subunit 3
Synonyms
MMRRC Submission 040315-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.971) question?
Stock #R2324 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location90391388-90433622 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90394094 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 827 (L827P)
Ref Sequence ENSEMBL: ENSMUSP00000071422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029541] [ENSMUST00000029542] [ENSMUST00000071488] [ENSMUST00000196530]
Predicted Effect probably benign
Transcript: ENSMUST00000029541
SMART Domains Protein: ENSMUSP00000029541
Gene: ENSMUSG00000027932

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 38 56 N/A INTRINSIC
Pfam:AMP-binding 138 535 9.2e-62 PFAM
Pfam:AMP-binding_C 543 619 9.6e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000029542
AA Change: L827P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029542
Gene: ENSMUSG00000027933
AA Change: L827P

DomainStartEndE-ValueType
low complexity region 11 33 N/A INTRINSIC
Pfam:DUF2356 269 493 6e-110 PFAM
low complexity region 557 568 N/A INTRINSIC
low complexity region 632 647 N/A INTRINSIC
low complexity region 666 678 N/A INTRINSIC
coiled coil region 913 940 N/A INTRINSIC
low complexity region 1006 1019 N/A INTRINSIC
low complexity region 1021 1031 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000071488
AA Change: L827P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071422
Gene: ENSMUSG00000027933
AA Change: L827P

DomainStartEndE-ValueType
low complexity region 11 33 N/A INTRINSIC
Pfam:DUF2356 269 493 6e-110 PFAM
low complexity region 557 568 N/A INTRINSIC
low complexity region 632 647 N/A INTRINSIC
low complexity region 666 678 N/A INTRINSIC
coiled coil region 913 940 N/A INTRINSIC
low complexity region 1006 1019 N/A INTRINSIC
low complexity region 1021 1031 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127064
Predicted Effect probably benign
Transcript: ENSMUST00000132041
SMART Domains Protein: ENSMUSP00000122599
Gene: ENSMUSG00000027932

DomainStartEndE-ValueType
low complexity region 40 64 N/A INTRINSIC
low complexity region 68 89 N/A INTRINSIC
low complexity region 91 106 N/A INTRINSIC
Pfam:AMP-binding 147 501 5.3e-50 PFAM
Pfam:AMP-binding_C 509 585 2.9e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144572
Predicted Effect probably damaging
Transcript: ENSMUST00000196530
AA Change: L827P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143196
Gene: ENSMUSG00000027933
AA Change: L827P

DomainStartEndE-ValueType
low complexity region 11 33 N/A INTRINSIC
Pfam:DUF2356 268 497 5.7e-114 PFAM
low complexity region 557 568 N/A INTRINSIC
low complexity region 632 647 N/A INTRINSIC
low complexity region 666 678 N/A INTRINSIC
coiled coil region 913 940 N/A INTRINSIC
low complexity region 1006 1018 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198776
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199992
Meta Mutation Damage Score 0.7685 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can form a complex with human single-strand DNA binding proteins 1 or 2 (hSSB1 and hSSB2) and other proteins to mediate genome stability and the DNA damage response. The encoded protein is also part of a multiprotein complex that interacts with the C-terminal domain of RNA polymerase II large subunit to help regulate processing of U1 and U2 small nuclear RNAs. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akna T C 4: 63,371,802 D1223G possibly damaging Het
Ankrd42 C A 7: 92,623,978 R147L probably damaging Het
Apopt1 A G 12: 111,724,350 E112G possibly damaging Het
Cep152 T C 2: 125,563,462 I1717V probably benign Het
Clca3a2 A G 3: 144,806,280 probably null Het
Dnhd1 A T 7: 105,710,090 H3544L probably damaging Het
Dpy19l4 T C 4: 11,276,857 probably benign Het
Efcab8 A G 2: 153,783,809 probably null Het
Esyt2 A G 12: 116,367,821 N773S possibly damaging Het
Gm281 A T 14: 13,868,077 I204N probably damaging Het
Hectd4 G A 5: 121,315,437 G613D probably damaging Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Irf9 T C 14: 55,605,910 probably null Het
Lactb2 T C 1: 13,638,296 D176G probably damaging Het
Lmntd2 A T 7: 141,210,788 S516T possibly damaging Het
Lrp1 C A 10: 127,566,586 A2239S possibly damaging Het
Lrrc56 A G 7: 141,205,563 probably benign Het
Nfic A G 10: 81,406,087 probably null Het
Notch3 G A 17: 32,150,134 probably benign Het
Oas2 T C 5: 120,743,274 K251E probably benign Het
Olfr178 T C 16: 58,890,140 T27A probably benign Het
Pabpc4 T C 4: 123,297,778 probably benign Het
Piwil4 C T 9: 14,736,908 R125H possibly damaging Het
Rbsn A G 6: 92,193,966 Y325H probably damaging Het
Rhox2e C A X: 37,530,863 P69Q probably damaging Het
Skint6 T C 4: 112,872,457 probably null Het
Tmem165 T C 5: 76,204,824 probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ttc13 A G 8: 124,679,057 V499A probably damaging Het
Vax2 G T 6: 83,711,325 R10L possibly damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Ints3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Ints3 APN 3 90406329 missense probably damaging 1.00
IGL01339:Ints3 APN 3 90415156 critical splice donor site probably null
IGL01398:Ints3 APN 3 90392823 missense probably damaging 1.00
IGL01599:Ints3 APN 3 90394322 critical splice donor site probably null
IGL01864:Ints3 APN 3 90415179 missense probably benign 0.33
IGL01984:Ints3 APN 3 90392226 missense possibly damaging 0.79
IGL02325:Ints3 APN 3 90404042 missense probably damaging 1.00
IGL02516:Ints3 APN 3 90403108 missense probably damaging 1.00
IGL02867:Ints3 APN 3 90392836 missense probably damaging 1.00
IGL02889:Ints3 APN 3 90392836 missense probably damaging 1.00
IGL02975:Ints3 APN 3 90401837 splice site probably benign
PIT4431001:Ints3 UTSW 3 90396460 missense probably damaging 0.99
R0003:Ints3 UTSW 3 90408511 missense probably benign 0.00
R0003:Ints3 UTSW 3 90408511 missense probably benign 0.00
R0069:Ints3 UTSW 3 90400647 splice site probably benign
R0069:Ints3 UTSW 3 90400647 splice site probably benign
R1450:Ints3 UTSW 3 90432828 missense probably damaging 1.00
R1985:Ints3 UTSW 3 90400303 critical splice donor site probably null
R2425:Ints3 UTSW 3 90394110 missense possibly damaging 0.91
R2920:Ints3 UTSW 3 90393162 missense probably benign 0.22
R3937:Ints3 UTSW 3 90403987 nonsense probably null
R4678:Ints3 UTSW 3 90408510 missense possibly damaging 0.47
R4679:Ints3 UTSW 3 90408510 missense possibly damaging 0.47
R4719:Ints3 UTSW 3 90415521 missense probably benign 0.20
R4726:Ints3 UTSW 3 90393777 missense probably damaging 1.00
R4993:Ints3 UTSW 3 90415507 missense probably benign 0.05
R5154:Ints3 UTSW 3 90415561 missense probably benign 0.01
R5243:Ints3 UTSW 3 90401144 frame shift probably null
R5454:Ints3 UTSW 3 90408527 missense possibly damaging 0.72
R5678:Ints3 UTSW 3 90403548 missense probably damaging 0.99
R6123:Ints3 UTSW 3 90413554 missense probably benign 0.01
R6548:Ints3 UTSW 3 90392124 unclassified probably benign
R6916:Ints3 UTSW 3 90406334 missense probably damaging 1.00
R7265:Ints3 UTSW 3 90403983 critical splice donor site probably null
R7332:Ints3 UTSW 3 90415512 missense probably damaging 0.98
R7699:Ints3 UTSW 3 90421804 missense probably benign 0.00
R7700:Ints3 UTSW 3 90421804 missense probably benign 0.00
R7790:Ints3 UTSW 3 90400413 missense probably benign 0.09
R7827:Ints3 UTSW 3 90424012 missense probably benign 0.11
R7915:Ints3 UTSW 3 90432825 missense probably benign 0.06
R8118:Ints3 UTSW 3 90400299 splice site probably null
R8119:Ints3 UTSW 3 90392300 missense probably damaging 0.97
R8193:Ints3 UTSW 3 90400622 missense possibly damaging 0.82
Z1177:Ints3 UTSW 3 90406356 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCAGTCTTCAGCTGCTAGG -3'
(R):5'- AGTTACTAGGTCTTCCAGGAACC -3'

Sequencing Primer
(F):5'- TCTTCAGCTGCTAGGCCTGG -3'
(R):5'- GGACATCAACTGTGTTTAGCAGTGAC -3'
Posted On2014-10-30