Incidental Mutation 'R2324:Ints12'
ID244835
Institutional Source Beutler Lab
Gene Symbol Ints12
Ensembl Gene ENSMUSG00000028016
Gene Nameintegrator complex subunit 12
SynonymsPhf22, 2810027J24Rik, 1110020M19Rik, 4930529N21Rik, A230056J18Rik
MMRRC Submission 040315-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2324 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location133091840-133110988 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 133109365 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 444 (M444I)
Ref Sequence ENSEMBL: ENSMUSP00000029650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029650] [ENSMUST00000147041]
PDB Structure
Solution structure of PHD domain in protein NP_082203 [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029650
AA Change: M444I

PolyPhen 2 Score 0.595 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000029650
Gene: ENSMUSG00000028016
AA Change: M444I

DomainStartEndE-ValueType
internal_repeat_1 23 67 4.54e-5 PROSPERO
low complexity region 74 82 N/A INTRINSIC
internal_repeat_1 91 139 4.54e-5 PROSPERO
PHD 160 212 4.63e-9 SMART
low complexity region 219 240 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
low complexity region 337 373 N/A INTRINSIC
low complexity region 381 436 N/A INTRINSIC
low complexity region 451 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147041
SMART Domains Protein: ENSMUSP00000114238
Gene: ENSMUSG00000040969

DomainStartEndE-ValueType
low complexity region 34 49 N/A INTRINSIC
RhoGEF 98 284 2.72e-33 SMART
low complexity region 296 312 N/A INTRINSIC
BAR 315 514 4.8e-29 SMART
SH3 584 643 5.56e-1 SMART
low complexity region 678 689 N/A INTRINSIC
SH3 709 768 1.95e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160669
Meta Mutation Damage Score 0.1323 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS12 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akna T C 4: 63,371,802 D1223G possibly damaging Het
Ankrd42 C A 7: 92,623,978 R147L probably damaging Het
Apopt1 A G 12: 111,724,350 E112G possibly damaging Het
Cep152 T C 2: 125,563,462 I1717V probably benign Het
Clca3a2 A G 3: 144,806,280 probably null Het
Dnhd1 A T 7: 105,710,090 H3544L probably damaging Het
Dpy19l4 T C 4: 11,276,857 probably benign Het
Efcab8 A G 2: 153,783,809 probably null Het
Esyt2 A G 12: 116,367,821 N773S possibly damaging Het
Gm281 A T 14: 13,868,077 I204N probably damaging Het
Hectd4 G A 5: 121,315,437 G613D probably damaging Het
Ints3 A G 3: 90,394,094 L827P probably damaging Het
Irf9 T C 14: 55,605,910 probably null Het
Lactb2 T C 1: 13,638,296 D176G probably damaging Het
Lmntd2 A T 7: 141,210,788 S516T possibly damaging Het
Lrp1 C A 10: 127,566,586 A2239S possibly damaging Het
Lrrc56 A G 7: 141,205,563 probably benign Het
Nfic A G 10: 81,406,087 probably null Het
Notch3 G A 17: 32,150,134 probably benign Het
Oas2 T C 5: 120,743,274 K251E probably benign Het
Olfr178 T C 16: 58,890,140 T27A probably benign Het
Pabpc4 T C 4: 123,297,778 probably benign Het
Piwil4 C T 9: 14,736,908 R125H possibly damaging Het
Rbsn A G 6: 92,193,966 Y325H probably damaging Het
Rhox2e C A X: 37,530,863 P69Q probably damaging Het
Skint6 T C 4: 112,872,457 probably null Het
Tmem165 T C 5: 76,204,824 probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ttc13 A G 8: 124,679,057 V499A probably damaging Het
Vax2 G T 6: 83,711,325 R10L possibly damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Ints12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Ints12 APN 3 133100809 critical splice donor site probably null
R0243:Ints12 UTSW 3 133109045 missense probably benign 0.37
R0847:Ints12 UTSW 3 133108842 missense possibly damaging 0.72
R2118:Ints12 UTSW 3 133109160 missense probably damaging 0.98
R2323:Ints12 UTSW 3 133109365 missense possibly damaging 0.60
R2384:Ints12 UTSW 3 133109103 splice site probably null
R3055:Ints12 UTSW 3 133109365 missense possibly damaging 0.60
R3056:Ints12 UTSW 3 133109365 missense possibly damaging 0.60
R3919:Ints12 UTSW 3 133100683 missense probably benign
R4431:Ints12 UTSW 3 133102481 missense probably damaging 1.00
R4594:Ints12 UTSW 3 133108868 missense probably benign 0.00
R4598:Ints12 UTSW 3 133098453 missense probably benign
R4599:Ints12 UTSW 3 133098453 missense probably benign
R4702:Ints12 UTSW 3 133096785 missense probably damaging 1.00
R5083:Ints12 UTSW 3 133100777 missense possibly damaging 0.54
R5507:Ints12 UTSW 3 133109160 missense probably damaging 1.00
R5894:Ints12 UTSW 3 133098558 missense probably damaging 1.00
R6647:Ints12 UTSW 3 133096878 missense possibly damaging 0.88
R8245:Ints12 UTSW 3 133108872 missense probably benign
Z1176:Ints12 UTSW 3 133102464 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGGGTCTTCCTAGTCCTAGTAG -3'
(R):5'- GAAGCTCTTGTCATGCATCAGTC -3'

Sequencing Primer
(F):5'- AGTTTAGTTCCTGGAGGCAGCAG -3'
(R):5'- TGTCATGCATCAGTCATTATAATCAC -3'
Posted On2014-10-30