Incidental Mutation 'R2324:Clca3a2'
ID244836
Institutional Source Beutler Lab
Gene Symbol Clca3a2
Ensembl Gene ENSMUSG00000028262
Gene Namechloride channel accessory 3A2
SynonymsClca2
MMRRC Submission 040315-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R2324 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location144796559-144819494 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 144806280 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000029929] [ENSMUST00000199029]
Predicted Effect probably null
Transcript: ENSMUST00000029929
SMART Domains Protein: ENSMUSP00000029929
Gene: ENSMUSG00000028262

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 478 1.5e-21 SMART
FN3 758 857 5.49e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000197013
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198543
Predicted Effect probably benign
Transcript: ENSMUST00000199029
SMART Domains Protein: ENSMUSP00000143543
Gene: ENSMUSG00000028262

DomainStartEndE-ValueType
Pfam:CLCA 1 188 6.5e-77 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akna T C 4: 63,371,802 D1223G possibly damaging Het
Ankrd42 C A 7: 92,623,978 R147L probably damaging Het
Apopt1 A G 12: 111,724,350 E112G possibly damaging Het
Cep152 T C 2: 125,563,462 I1717V probably benign Het
Dnhd1 A T 7: 105,710,090 H3544L probably damaging Het
Dpy19l4 T C 4: 11,276,857 probably benign Het
Efcab8 A G 2: 153,783,809 probably null Het
Esyt2 A G 12: 116,367,821 N773S possibly damaging Het
Gm281 A T 14: 13,868,077 I204N probably damaging Het
Hectd4 G A 5: 121,315,437 G613D probably damaging Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Ints3 A G 3: 90,394,094 L827P probably damaging Het
Irf9 T C 14: 55,605,910 probably null Het
Lactb2 T C 1: 13,638,296 D176G probably damaging Het
Lmntd2 A T 7: 141,210,788 S516T possibly damaging Het
Lrp1 C A 10: 127,566,586 A2239S possibly damaging Het
Lrrc56 A G 7: 141,205,563 probably benign Het
Nfic A G 10: 81,406,087 probably null Het
Notch3 G A 17: 32,150,134 probably benign Het
Oas2 T C 5: 120,743,274 K251E probably benign Het
Olfr178 T C 16: 58,890,140 T27A probably benign Het
Pabpc4 T C 4: 123,297,778 probably benign Het
Piwil4 C T 9: 14,736,908 R125H possibly damaging Het
Rbsn A G 6: 92,193,966 Y325H probably damaging Het
Rhox2e C A X: 37,530,863 P69Q probably damaging Het
Skint6 T C 4: 112,872,457 probably null Het
Tmem165 T C 5: 76,204,824 probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ttc13 A G 8: 124,679,057 V499A probably damaging Het
Vax2 G T 6: 83,711,325 R10L possibly damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Clca3a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Clca3a2 APN 3 144813627 nonsense probably null
IGL01663:Clca3a2 APN 3 144817155 missense probably damaging 0.97
IGL01779:Clca3a2 APN 3 144819378 missense possibly damaging 0.47
IGL02066:Clca3a2 APN 3 144813455 missense probably benign
IGL02301:Clca3a2 APN 3 144806372 missense probably damaging 0.98
IGL02619:Clca3a2 APN 3 144806322 missense probably damaging 1.00
IGL02852:Clca3a2 APN 3 144806343 missense probably damaging 0.98
IGL02901:Clca3a2 APN 3 144816768 missense probably damaging 1.00
IGL03162:Clca3a2 APN 3 144806416 missense probably damaging 1.00
R0032:Clca3a2 UTSW 3 144816733 missense probably benign 0.01
R0244:Clca3a2 UTSW 3 144813898 missense possibly damaging 0.90
R1249:Clca3a2 UTSW 3 144803004 missense possibly damaging 0.80
R1370:Clca3a2 UTSW 3 144813863 splice site probably benign
R1586:Clca3a2 UTSW 3 144810716 missense possibly damaging 0.94
R1776:Clca3a2 UTSW 3 144813920 missense probably damaging 1.00
R1797:Clca3a2 UTSW 3 144797637 missense probably benign 0.01
R1869:Clca3a2 UTSW 3 144806403 missense probably benign 0.44
R1871:Clca3a2 UTSW 3 144797637 missense probably benign 0.01
R1919:Clca3a2 UTSW 3 144810696 missense probably benign
R1923:Clca3a2 UTSW 3 144805730 missense probably damaging 1.00
R2200:Clca3a2 UTSW 3 144813924 missense probably benign 0.10
R2937:Clca3a2 UTSW 3 144813918 missense probably benign 0.06
R3429:Clca3a2 UTSW 3 144806327 missense probably benign 0.07
R3434:Clca3a2 UTSW 3 144808761 unclassified probably benign
R3551:Clca3a2 UTSW 3 144803081 missense probably damaging 1.00
R3952:Clca3a2 UTSW 3 144803061 missense probably damaging 1.00
R4120:Clca3a2 UTSW 3 144810852 missense probably benign 0.25
R4383:Clca3a2 UTSW 3 144806320 missense probably benign 0.02
R4518:Clca3a2 UTSW 3 144808705 missense probably damaging 1.00
R4598:Clca3a2 UTSW 3 144805683 missense probably damaging 1.00
R4801:Clca3a2 UTSW 3 144807351 missense possibly damaging 0.95
R4802:Clca3a2 UTSW 3 144807351 missense possibly damaging 0.95
R4816:Clca3a2 UTSW 3 144810852 missense probably benign 0.25
R4934:Clca3a2 UTSW 3 144817931 missense probably damaging 1.00
R4942:Clca3a2 UTSW 3 144806502 missense probably damaging 1.00
R5123:Clca3a2 UTSW 3 144806343 missense probably damaging 1.00
R5156:Clca3a2 UTSW 3 144805838 missense probably benign 0.26
R5275:Clca3a2 UTSW 3 144813579 missense probably damaging 1.00
R5372:Clca3a2 UTSW 3 144797525 missense probably benign 0.00
R5656:Clca3a2 UTSW 3 144797632 missense probably benign 0.26
R6059:Clca3a2 UTSW 3 144810770 missense probably damaging 1.00
R6155:Clca3a2 UTSW 3 144819357 missense probably damaging 0.99
R6254:Clca3a2 UTSW 3 144802134 missense probably benign
R6336:Clca3a2 UTSW 3 144806478 missense probably benign
R6470:Clca3a2 UTSW 3 144804263 unclassified probably null
R6593:Clca3a2 UTSW 3 144808577 critical splice donor site probably null
R6631:Clca3a2 UTSW 3 144813644 missense probably benign
R6826:Clca3a2 UTSW 3 144818054 missense possibly damaging 0.46
R6836:Clca3a2 UTSW 3 144806383 missense probably damaging 0.97
R6896:Clca3a2 UTSW 3 144808701 missense probably damaging 1.00
R7211:Clca3a2 UTSW 3 144814014 missense probably benign 0.00
R7324:Clca3a2 UTSW 3 144808611 missense probably damaging 0.99
R7411:Clca3a2 UTSW 3 144802099 missense probably damaging 1.00
R7486:Clca3a2 UTSW 3 144797601 missense probably damaging 1.00
R7491:Clca3a2 UTSW 3 144813579 missense probably damaging 1.00
R7521:Clca3a2 UTSW 3 144801913 makesense probably null
R7889:Clca3a2 UTSW 3 144810813 nonsense probably null
R7972:Clca3a2 UTSW 3 144810813 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGCATGGTAAACAACTGTCCTAC -3'
(R):5'- TACCTGTGGACAGTACCGTC -3'

Sequencing Primer
(F):5'- GAGTAGAGACCTACATTGCTAACCTC -3'
(R):5'- TGGACAGTACCGTCGGCAAC -3'
Posted On2014-10-30