Incidental Mutation 'R2324:Pabpc4'
ID244840
Institutional Source Beutler Lab
Gene Symbol Pabpc4
Ensembl Gene ENSMUSG00000011257
Gene Namepoly(A) binding protein, cytoplasmic 4
Synonyms
MMRRC Submission 040315-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2324 (G1)
Quality Score221
Status Validated
Chromosome4
Chromosomal Location123262351-123298925 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 123297778 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078734] [ENSMUST00000080178] [ENSMUST00000106241] [ENSMUST00000106243] [ENSMUST00000183940]
Predicted Effect probably benign
Transcript: ENSMUST00000078734
SMART Domains Protein: ENSMUSP00000077794
Gene: ENSMUSG00000011257

DomainStartEndE-ValueType
RRM 12 85 1.47e-21 SMART
RRM 100 171 2.91e-25 SMART
RRM 192 264 1.27e-25 SMART
RRM 295 366 2.54e-25 SMART
low complexity region 478 493 N/A INTRINSIC
low complexity region 503 516 N/A INTRINSIC
PolyA 534 597 4.49e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000080178
SMART Domains Protein: ENSMUSP00000079070
Gene: ENSMUSG00000011257

DomainStartEndE-ValueType
RRM 12 85 1.47e-21 SMART
RRM 100 171 2.91e-25 SMART
RRM 192 264 1.27e-25 SMART
RRM 295 366 2.54e-25 SMART
low complexity region 523 538 N/A INTRINSIC
low complexity region 548 561 N/A INTRINSIC
PolyA 579 642 4.49e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083844
Predicted Effect probably benign
Transcript: ENSMUST00000106241
SMART Domains Protein: ENSMUSP00000101848
Gene: ENSMUSG00000011257

DomainStartEndE-ValueType
RRM 12 85 1.47e-21 SMART
RRM 100 171 2.91e-25 SMART
RRM 192 264 1.27e-25 SMART
RRM 295 366 2.54e-25 SMART
low complexity region 507 522 N/A INTRINSIC
low complexity region 532 545 N/A INTRINSIC
PolyA 563 626 4.49e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106243
SMART Domains Protein: ENSMUSP00000101850
Gene: ENSMUSG00000011257

DomainStartEndE-ValueType
RRM 12 85 6.2e-24 SMART
RRM 100 171 1.2e-27 SMART
RRM 192 264 5.4e-28 SMART
RRM 295 366 1e-27 SMART
low complexity region 494 509 N/A INTRINSIC
low complexity region 519 532 N/A INTRINSIC
PolyA 550 613 2.1e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124991
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146156
Predicted Effect probably benign
Transcript: ENSMUST00000183940
SMART Domains Protein: ENSMUSP00000139135
Gene: ENSMUSG00000011257

DomainStartEndE-ValueType
RRM 12 85 1.47e-21 SMART
RRM 100 167 7.64e-20 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Poly(A)-binding proteins (PABPs) bind to the poly(A) tail present at the 3-prime ends of most eukaryotic mRNAs. PABPC4 or IPABP (inducible PABP) was isolated as an activation-induced T-cell mRNA encoding a protein. Activation of T cells increased PABPC4 mRNA levels in T cells approximately 5-fold. PABPC4 contains 4 RNA-binding domains and proline-rich C terminus. PABPC4 is localized primarily to the cytoplasm. It is suggested that PABPC4 might be necessary for regulation of stability of labile mRNA species in activated T cells. PABPC4 was also identified as an antigen, APP1 (activated-platelet protein-1), expressed on thrombin-activated rabbit platelets. PABPC4 may also be involved in the regulation of protein translation in platelets and megakaryocytes or may participate in the binding or stabilization of polyadenylates in platelet dense granules. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akna T C 4: 63,371,802 D1223G possibly damaging Het
Ankrd42 C A 7: 92,623,978 R147L probably damaging Het
Apopt1 A G 12: 111,724,350 E112G possibly damaging Het
Cep152 T C 2: 125,563,462 I1717V probably benign Het
Clca3a2 A G 3: 144,806,280 probably null Het
Dnhd1 A T 7: 105,710,090 H3544L probably damaging Het
Dpy19l4 T C 4: 11,276,857 probably benign Het
Efcab8 A G 2: 153,783,809 probably null Het
Esyt2 A G 12: 116,367,821 N773S possibly damaging Het
Gm281 A T 14: 13,868,077 I204N probably damaging Het
Hectd4 G A 5: 121,315,437 G613D probably damaging Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Ints3 A G 3: 90,394,094 L827P probably damaging Het
Irf9 T C 14: 55,605,910 probably null Het
Lactb2 T C 1: 13,638,296 D176G probably damaging Het
Lmntd2 A T 7: 141,210,788 S516T possibly damaging Het
Lrp1 C A 10: 127,566,586 A2239S possibly damaging Het
Lrrc56 A G 7: 141,205,563 probably benign Het
Nfic A G 10: 81,406,087 probably null Het
Notch3 G A 17: 32,150,134 probably benign Het
Oas2 T C 5: 120,743,274 K251E probably benign Het
Olfr178 T C 16: 58,890,140 T27A probably benign Het
Piwil4 C T 9: 14,736,908 R125H possibly damaging Het
Rbsn A G 6: 92,193,966 Y325H probably damaging Het
Rhox2e C A X: 37,530,863 P69Q probably damaging Het
Skint6 T C 4: 112,872,457 probably null Het
Tmem165 T C 5: 76,204,824 probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ttc13 A G 8: 124,679,057 V499A probably damaging Het
Vax2 G T 6: 83,711,325 R10L possibly damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Pabpc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Pabpc4 APN 4 123286704 missense probably damaging 1.00
IGL00970:Pabpc4 APN 4 123286815 missense probably damaging 1.00
IGL03093:Pabpc4 APN 4 123286709 missense probably damaging 0.96
R0383:Pabpc4 UTSW 4 123297942 missense probably damaging 1.00
R0924:Pabpc4 UTSW 4 123294665 missense possibly damaging 0.56
R1076:Pabpc4 UTSW 4 123292908 missense possibly damaging 0.74
R1381:Pabpc4 UTSW 4 123289059 missense probably damaging 1.00
R1908:Pabpc4 UTSW 4 123289068 missense possibly damaging 0.68
R1957:Pabpc4 UTSW 4 123286865 missense probably damaging 1.00
R2567:Pabpc4 UTSW 4 123297951 missense probably damaging 1.00
R3768:Pabpc4 UTSW 4 123294612 missense probably damaging 1.00
R4350:Pabpc4 UTSW 4 123290267 missense probably damaging 1.00
R4352:Pabpc4 UTSW 4 123290267 missense probably damaging 1.00
R4353:Pabpc4 UTSW 4 123290267 missense probably damaging 1.00
R5304:Pabpc4 UTSW 4 123290307 missense probably benign 0.43
R5386:Pabpc4 UTSW 4 123294997 missense probably benign 0.15
R5622:Pabpc4 UTSW 4 123291731 critical splice acceptor site probably null
R6853:Pabpc4 UTSW 4 123294743 missense possibly damaging 0.60
R7558:Pabpc4 UTSW 4 123294620 missense possibly damaging 0.94
R7602:Pabpc4 UTSW 4 123292892 missense possibly damaging 0.59
R7631:Pabpc4 UTSW 4 123288970 missense probably damaging 0.96
R7714:Pabpc4 UTSW 4 123295309 missense probably benign
R7935:Pabpc4 UTSW 4 123298044 missense probably benign 0.13
R7951:Pabpc4 UTSW 4 123283739 missense probably damaging 0.99
R8074:Pabpc4 UTSW 4 123286715 missense probably benign
Z1176:Pabpc4 UTSW 4 123295274 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGCACAGTAGTTTTAGGCTGC -3'
(R):5'- CAGCTCAGAGTTGTCGATTTCC -3'

Sequencing Primer
(F):5'- TTGTTCCCCAGAGACAGGACTG -3'
(R):5'- CAGAGTTGTCGATTTCCAGCAGC -3'
Posted On2014-10-30