Incidental Mutation 'R2324:Tmem165'
ID244842
Institutional Source Beutler Lab
Gene Symbol Tmem165
Ensembl Gene ENSMUSG00000029234
Gene Nametransmembrane protein 165
SynonymspFT27, Tparl, Tpardl
MMRRC Submission 040315-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.301) question?
Stock #R2324 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location76183880-76209245 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 76204824 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031144] [ENSMUST00000130842]
Predicted Effect probably benign
Transcript: ENSMUST00000031144
SMART Domains Protein: ENSMUSP00000031144
Gene: ENSMUSG00000029234

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 44 59 N/A INTRINSIC
Pfam:UPF0016 98 171 1.4e-25 PFAM
coiled coil region 184 211 N/A INTRINSIC
Pfam:UPF0016 237 311 4.6e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130842
SMART Domains Protein: ENSMUSP00000114647
Gene: ENSMUSG00000029234

DomainStartEndE-ValueType
Pfam:UPF0016 1 52 1.7e-12 PFAM
low complexity region 66 81 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153633
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a predicted transmembrane protein with a perinuclear Golgi-like distribution in fibroblasts. Mutations in this gene are associated with the autosomal recessive disorder congenital disorder of glycosylation, type IIk. Knockdown of this gene's expression causes decreased sialylation in HEK cells and suggests this gene plays a role in terminal Golgi glycosylation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akna T C 4: 63,371,802 D1223G possibly damaging Het
Ankrd42 C A 7: 92,623,978 R147L probably damaging Het
Apopt1 A G 12: 111,724,350 E112G possibly damaging Het
Cep152 T C 2: 125,563,462 I1717V probably benign Het
Clca3a2 A G 3: 144,806,280 probably null Het
Dnhd1 A T 7: 105,710,090 H3544L probably damaging Het
Dpy19l4 T C 4: 11,276,857 probably benign Het
Efcab8 A G 2: 153,783,809 probably null Het
Esyt2 A G 12: 116,367,821 N773S possibly damaging Het
Gm281 A T 14: 13,868,077 I204N probably damaging Het
Hectd4 G A 5: 121,315,437 G613D probably damaging Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Ints3 A G 3: 90,394,094 L827P probably damaging Het
Irf9 T C 14: 55,605,910 probably null Het
Lactb2 T C 1: 13,638,296 D176G probably damaging Het
Lmntd2 A T 7: 141,210,788 S516T possibly damaging Het
Lrp1 C A 10: 127,566,586 A2239S possibly damaging Het
Lrrc56 A G 7: 141,205,563 probably benign Het
Nfic A G 10: 81,406,087 probably null Het
Notch3 G A 17: 32,150,134 probably benign Het
Oas2 T C 5: 120,743,274 K251E probably benign Het
Olfr178 T C 16: 58,890,140 T27A probably benign Het
Pabpc4 T C 4: 123,297,778 probably benign Het
Piwil4 C T 9: 14,736,908 R125H possibly damaging Het
Rbsn A G 6: 92,193,966 Y325H probably damaging Het
Rhox2e C A X: 37,530,863 P69Q probably damaging Het
Skint6 T C 4: 112,872,457 probably null Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ttc13 A G 8: 124,679,057 V499A probably damaging Het
Vax2 G T 6: 83,711,325 R10L possibly damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Tmem165
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01758:Tmem165 APN 5 76204163 missense probably damaging 1.00
IGL03237:Tmem165 APN 5 76199509 nonsense probably null
R1743:Tmem165 UTSW 5 76207826 missense probably damaging 1.00
R7549:Tmem165 UTSW 5 76208568 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TCTTAAATGGGCCAGATGTTGAAAC -3'
(R):5'- AGCATGCAGAAGTCATGAGC -3'

Sequencing Primer
(F):5'- GCCAGATGTTGAAACTGGTAC -3'
(R):5'- TCATGAGCAGAAAAGTAAGCAAC -3'
Posted On2014-10-30