Incidental Mutation 'R2324:Oas2'
ID244843
Institutional Source Beutler Lab
Gene Symbol Oas2
Ensembl Gene ENSMUSG00000032690
Gene Name2'-5' oligoadenylate synthetase 2
Synonyms2'-5' oligoadenylate synthetase-like 11, Oasl11
MMRRC Submission 040315-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R2324 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location120730333-120749853 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120743274 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 251 (K251E)
Ref Sequence ENSEMBL: ENSMUSP00000080209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053909] [ENSMUST00000081491]
Predicted Effect probably benign
Transcript: ENSMUST00000053909
AA Change: K251E

PolyPhen 2 Score 0.426 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000060082
Gene: ENSMUSG00000032690
AA Change: K251E

DomainStartEndE-ValueType
low complexity region 10 33 N/A INTRINSIC
Pfam:OAS1_C 190 378 5.6e-75 PFAM
Pfam:NTP_transf_2 412 516 4e-9 PFAM
Pfam:OAS1_C 533 724 3.2e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081491
AA Change: K251E

PolyPhen 2 Score 0.426 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000080209
Gene: ENSMUSG00000032690
AA Change: K251E

DomainStartEndE-ValueType
low complexity region 10 33 N/A INTRINSIC
Pfam:OAS1_C 191 376 1.9e-77 PFAM
Pfam:NTP_transf_2 412 516 1.3e-10 PFAM
Pfam:OAS1_C 534 722 2.6e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146101
SMART Domains Protein: ENSMUSP00000122053
Gene: ENSMUSG00000032690

DomainStartEndE-ValueType
Pfam:OAS1_C 45 233 2.8e-88 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201095
Meta Mutation Damage Score 0.4061 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the 2-5A synthetase family, essential proteins involved in the innate immune response to viral infection. The encoded protein is induced by interferons and uses adenosine triphosphate in 2'-specific nucleotidyl transfer reactions to synthesize 2',5'-oligoadenylates (2-5As). These molecules activate latent RNase L, which results in viral RNA degradation and the inhibition of viral replication. The three known members of this gene family are located in a cluster on chromosome 12. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: In nursing mothers, homozygous knockout (by a point mutation in a critical domain) results in a failure of the alveoli to expand and a failure to lactate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akna T C 4: 63,371,802 D1223G possibly damaging Het
Ankrd42 C A 7: 92,623,978 R147L probably damaging Het
Apopt1 A G 12: 111,724,350 E112G possibly damaging Het
Cep152 T C 2: 125,563,462 I1717V probably benign Het
Clca3a2 A G 3: 144,806,280 probably null Het
Dnhd1 A T 7: 105,710,090 H3544L probably damaging Het
Dpy19l4 T C 4: 11,276,857 probably benign Het
Efcab8 A G 2: 153,783,809 probably null Het
Esyt2 A G 12: 116,367,821 N773S possibly damaging Het
Gm281 A T 14: 13,868,077 I204N probably damaging Het
Hectd4 G A 5: 121,315,437 G613D probably damaging Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Ints3 A G 3: 90,394,094 L827P probably damaging Het
Irf9 T C 14: 55,605,910 probably null Het
Lactb2 T C 1: 13,638,296 D176G probably damaging Het
Lmntd2 A T 7: 141,210,788 S516T possibly damaging Het
Lrp1 C A 10: 127,566,586 A2239S possibly damaging Het
Lrrc56 A G 7: 141,205,563 probably benign Het
Nfic A G 10: 81,406,087 probably null Het
Notch3 G A 17: 32,150,134 probably benign Het
Olfr178 T C 16: 58,890,140 T27A probably benign Het
Pabpc4 T C 4: 123,297,778 probably benign Het
Piwil4 C T 9: 14,736,908 R125H possibly damaging Het
Rbsn A G 6: 92,193,966 Y325H probably damaging Het
Rhox2e C A X: 37,530,863 P69Q probably damaging Het
Skint6 T C 4: 112,872,457 probably null Het
Tmem165 T C 5: 76,204,824 probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ttc13 A G 8: 124,679,057 V499A probably damaging Het
Vax2 G T 6: 83,711,325 R10L possibly damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Oas2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Oas2 APN 5 120738363 missense probably damaging 1.00
IGL00784:Oas2 APN 5 120738363 missense probably damaging 1.00
IGL01388:Oas2 APN 5 120748592 missense probably damaging 1.00
IGL01643:Oas2 APN 5 120736187 splice site probably benign
IGL01660:Oas2 APN 5 120741223 missense probably benign 0.00
IGL02346:Oas2 APN 5 120736088 missense probably benign 0.30
IGL02403:Oas2 APN 5 120748750 missense possibly damaging 0.59
IGL03297:Oas2 APN 5 120735085 missense possibly damaging 0.91
R0149:Oas2 UTSW 5 120738401 missense probably damaging 0.99
R0344:Oas2 UTSW 5 120743087 missense probably damaging 1.00
R0361:Oas2 UTSW 5 120738401 missense probably damaging 0.99
R0387:Oas2 UTSW 5 120745672 splice site probably benign
R0465:Oas2 UTSW 5 120735055 missense probably damaging 0.99
R2100:Oas2 UTSW 5 120745675 critical splice donor site probably null
R2496:Oas2 UTSW 5 120748617 missense probably benign 0.00
R4357:Oas2 UTSW 5 120738669 critical splice donor site probably null
R4466:Oas2 UTSW 5 120749602 missense probably damaging 0.99
R4472:Oas2 UTSW 5 120741155 missense possibly damaging 0.81
R4632:Oas2 UTSW 5 120733481 missense probably benign 0.34
R4714:Oas2 UTSW 5 120733472 missense probably damaging 1.00
R4824:Oas2 UTSW 5 120738346 missense probably benign 0.32
R4872:Oas2 UTSW 5 120738534 missense probably damaging 1.00
R5629:Oas2 UTSW 5 120738451 nonsense probably null
R6351:Oas2 UTSW 5 120748538 missense probably benign
R6463:Oas2 UTSW 5 120734981 missense probably null 1.00
R6488:Oas2 UTSW 5 120738363 missense probably damaging 1.00
R6787:Oas2 UTSW 5 120738798 missense possibly damaging 0.77
R6945:Oas2 UTSW 5 120736139 missense probably benign 0.00
R7353:Oas2 UTSW 5 120738522 missense probably damaging 1.00
R7459:Oas2 UTSW 5 120749710 missense unknown
R7634:Oas2 UTSW 5 120733228 missense probably benign 0.18
R7639:Oas2 UTSW 5 120745686 nonsense probably null
R7958:Oas2 UTSW 5 120748766 missense probably benign 0.00
R7968:Oas2 UTSW 5 120738372 missense probably benign 0.38
R8158:Oas2 UTSW 5 120749773 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- TCCGGACTGTCTCATCCTCAA -3'
(R):5'- GAGAGACACCCCACATTTACCAT -3'

Sequencing Primer
(F):5'- GGACTGTCTCATCCTCAAAGTTG -3'
(R):5'- ACATTTACCATCACATAAGCATCC -3'
Posted On2014-10-30