Incidental Mutation 'R2324:Vax2'
ID244845
Institutional Source Beutler Lab
Gene Symbol Vax2
Ensembl Gene ENSMUSG00000034777
Gene Nameventral anterior homeobox 2
Synonyms
MMRRC Submission 040315-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.775) question?
Stock #R2324 (G1)
Quality Score104
Status Validated
Chromosome6
Chromosomal Location83711264-83738313 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 83711325 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 10 (R10L)
Ref Sequence ENSEMBL: ENSMUSP00000035976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037807]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037807
AA Change: R10L

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000035976
Gene: ENSMUSG00000034777
AA Change: R10L

DomainStartEndE-ValueType
low complexity region 7 32 N/A INTRINSIC
HOX 102 164 3.54e-27 SMART
low complexity region 169 180 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
low complexity region 233 247 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184408
Meta Mutation Damage Score 0.0621 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homeobox protein and is almost exclusively expressed in the ventral portion of the retina during development. In mouse studies, this gene was found to be required for the correct formation of the optic fissure and other aspects of retinal development. [provided by RefSeq, Sep 2008]
PHENOTYPE: Homozygous null mutants for one allele show incomplete closure of optic fissure leading to coloboma, the frequency of which is strongly influenced by genetic background. Homozygous null mutants for 2 different alleles have abnormal projections of ventralretinal ganglion cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akna T C 4: 63,371,802 D1223G possibly damaging Het
Ankrd42 C A 7: 92,623,978 R147L probably damaging Het
Apopt1 A G 12: 111,724,350 E112G possibly damaging Het
Cep152 T C 2: 125,563,462 I1717V probably benign Het
Clca3a2 A G 3: 144,806,280 probably null Het
Dnhd1 A T 7: 105,710,090 H3544L probably damaging Het
Dpy19l4 T C 4: 11,276,857 probably benign Het
Efcab8 A G 2: 153,783,809 probably null Het
Esyt2 A G 12: 116,367,821 N773S possibly damaging Het
Gm281 A T 14: 13,868,077 I204N probably damaging Het
Hectd4 G A 5: 121,315,437 G613D probably damaging Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Ints3 A G 3: 90,394,094 L827P probably damaging Het
Irf9 T C 14: 55,605,910 probably null Het
Lactb2 T C 1: 13,638,296 D176G probably damaging Het
Lmntd2 A T 7: 141,210,788 S516T possibly damaging Het
Lrp1 C A 10: 127,566,586 A2239S possibly damaging Het
Lrrc56 A G 7: 141,205,563 probably benign Het
Nfic A G 10: 81,406,087 probably null Het
Notch3 G A 17: 32,150,134 probably benign Het
Oas2 T C 5: 120,743,274 K251E probably benign Het
Olfr178 T C 16: 58,890,140 T27A probably benign Het
Pabpc4 T C 4: 123,297,778 probably benign Het
Piwil4 C T 9: 14,736,908 R125H possibly damaging Het
Rbsn A G 6: 92,193,966 Y325H probably damaging Het
Rhox2e C A X: 37,530,863 P69Q probably damaging Het
Skint6 T C 4: 112,872,457 probably null Het
Tmem165 T C 5: 76,204,824 probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ttc13 A G 8: 124,679,057 V499A probably damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Vax2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01568:Vax2 APN 6 83711537 missense possibly damaging 0.70
IGL02161:Vax2 APN 6 83737903 missense probably damaging 1.00
IGL02584:Vax2 APN 6 83711513 missense probably benign
R0316:Vax2 UTSW 6 83711444 missense possibly damaging 0.79
R0456:Vax2 UTSW 6 83711406 missense probably benign 0.00
R1006:Vax2 UTSW 6 83737777 missense probably damaging 1.00
R2045:Vax2 UTSW 6 83711270 start gained probably benign
R2217:Vax2 UTSW 6 83737889 missense probably damaging 0.98
R3979:Vax2 UTSW 6 83737547 missense probably damaging 0.98
R4755:Vax2 UTSW 6 83711397 missense probably damaging 0.99
R7203:Vax2 UTSW 6 83737900 missense probably damaging 0.99
R7242:Vax2 UTSW 6 83711316 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TTGCCAGGCTCTAAACACCG -3'
(R):5'- TTACCTCGTACCAGGATGCG -3'

Sequencing Primer
(F):5'- TGGATCCACCCAGAGTCCTG -3'
(R):5'- AGTGGTCTGTCTCACCGAG -3'
Posted On2014-10-30