Mutagenetix > Incidental Mutations

Incidental Mutation 'R2324:Rbsn'

244846

Institutional Source

Beutler Lab

Gene Symbol

Rbsn

Ensembl Gene

ENSMUSG00000014550

Gene Name

rabenosyn, RAB effector

Synonyms

5330426D11Rik, Rabenosyn-5, Zfyve20

MMRRC Submission

040315-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2324 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

92186712-92214925 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 92193966 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 325 (Y325H)

Ref Sequence

ENSEMBL: ENSMUSP00000014694 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014694]

Predicted Effect

probably damaging
Transcript: ENSMUST00000014694
AA Change: Y325H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000014694
Gene: ENSMUSG00000014550
AA Change: Y325H

Domain	Start	End	E-Value	Type
ZnF_C2H2	14	37	4.45e0	SMART
low complexity region	53	64	N/A	INTRINSIC
FYVE	148	260	2e-10	SMART
coiled coil region	377	412	N/A	INTRINSIC
Pfam:Rbsn	457	498	9e-21	PFAM
low complexity region	512	535	N/A	INTRINSIC
Pfam:NPF	547	736	2.3e-61	PFAM
Pfam:Rbsn	737	778	6.5e-16	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000124635
AA Change: Y56H

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141332

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204858

Meta Mutation Damage Score

0.3689

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

100% (33/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the FYVE zinc finger family of proteins. The encoded protein interacts with Ras-related proteins that regulate membrane trafficking. A missense mutation in this gene is associated with a defect in the early endocytic pathway. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akna	T	C	4: 63,371,802	D1223G	possibly damaging	Het
Ankrd42	C	A	7: 92,623,978	R147L	probably damaging	Het
Apopt1	A	G	12: 111,724,350	E112G	possibly damaging	Het
Cep152	T	C	2: 125,563,462	I1717V	probably benign	Het
Clca3a2	A	G	3: 144,806,280		probably null	Het
Dnhd1	A	T	7: 105,710,090	H3544L	probably damaging	Het
Dpy19l4	T	C	4: 11,276,857		probably benign	Het
Efcab8	A	G	2: 153,783,809		probably null	Het
Esyt2	A	G	12: 116,367,821	N773S	possibly damaging	Het
Gm281	A	T	14: 13,868,077	I204N	probably damaging	Het
Hectd4	G	A	5: 121,315,437	G613D	probably damaging	Het
Ints12	G	A	3: 133,109,365	M444I	possibly damaging	Het
Ints3	A	G	3: 90,394,094	L827P	probably damaging	Het
Irf9	T	C	14: 55,605,910		probably null	Het
Lactb2	T	C	1: 13,638,296	D176G	probably damaging	Het
Lmntd2	A	T	7: 141,210,788	S516T	possibly damaging	Het
Lrp1	C	A	10: 127,566,586	A2239S	possibly damaging	Het
Lrrc56	A	G	7: 141,205,563		probably benign	Het
Nfic	A	G	10: 81,406,087		probably null	Het
Notch3	G	A	17: 32,150,134		probably benign	Het
Oas2	T	C	5: 120,743,274	K251E	probably benign	Het
Olfr178	T	C	16: 58,890,140	T27A	probably benign	Het
Pabpc4	T	C	4: 123,297,778		probably benign	Het
Piwil4	C	T	9: 14,736,908	R125H	possibly damaging	Het
Rhox2e	C	A	X: 37,530,863	P69Q	probably damaging	Het
Skint6	T	C	4: 112,872,457		probably null	Het
Tmem165	T	C	5: 76,204,824		probably benign	Het
Tmem181a	T	A	17: 6,295,786	L185H	probably damaging	Het
Ttc13	A	G	8: 124,679,057	V499A	probably damaging	Het
Vax2	G	T	6: 83,711,325	R10L	possibly damaging	Het
Zfp988	A	C	4: 147,332,785	K559Q	probably benign	Het

Other mutations in Rbsn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01417:Rbsn	APN	6	92207119	missense	possibly damaging	0.82
IGL02073:Rbsn	APN	6	92189359	missense	probably damaging	1.00
IGL02962:Rbsn	APN	6	92190326	missense	probably benign	0.00
R0172:Rbsn	UTSW	6	92211607	missense	probably damaging	0.99
R0735:Rbsn	UTSW	6	92189693	missense	probably benign	0.01
R0909:Rbsn	UTSW	6	92189810	nonsense	probably null
R1146:Rbsn	UTSW	6	92201730	critical splice donor site	probably null
R1146:Rbsn	UTSW	6	92201730	critical splice donor site	probably null
R1728:Rbsn	UTSW	6	92190019	missense	possibly damaging	0.69
R1729:Rbsn	UTSW	6	92190019	missense	possibly damaging	0.69
R1784:Rbsn	UTSW	6	92190019	missense	possibly damaging	0.69
R2135:Rbsn	UTSW	6	92189873	missense	probably benign
R2183:Rbsn	UTSW	6	92189637	missense	probably benign	0.02
R2890:Rbsn	UTSW	6	92207123	missense	possibly damaging	0.52
R3729:Rbsn	UTSW	6	92191335	missense	possibly damaging	0.81
R4007:Rbsn	UTSW	6	92189819	missense	probably benign	0.00
R4356:Rbsn	UTSW	6	92207048	missense	possibly damaging	0.47
R5027:Rbsn	UTSW	6	92198250	missense	probably damaging	1.00
R5364:Rbsn	UTSW	6	92193977	missense	probably damaging	0.96
R5787:Rbsn	UTSW	6	92199816	missense	possibly damaging	0.81
R7092:Rbsn	UTSW	6	92189626	missense	probably damaging	1.00
R7134:Rbsn	UTSW	6	92201627	missense	probably damaging	1.00
R7165:Rbsn	UTSW	6	92191334	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- CTCGGATTTACACCCTACCCTAAG -3'
(R):5'- TGTCTCCATGAGTCTAAAATGCC -3'

Sequencing Primer
(F):5'- CTACCCTAAGTAGGTGTAACCAG -3'
(R):5'- CTTAGAAATAACCACCTGTCTCTGAG -3'

Posted On

2014-10-30