Incidental Mutation 'R2324:Rbsn'
ID244846
Institutional Source Beutler Lab
Gene Symbol Rbsn
Ensembl Gene ENSMUSG00000014550
Gene Namerabenosyn, RAB effector
Synonyms5330426D11Rik, Rabenosyn-5, Zfyve20
MMRRC Submission 040315-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2324 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location92186712-92214925 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92193966 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 325 (Y325H)
Ref Sequence ENSEMBL: ENSMUSP00000014694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014694]
Predicted Effect probably damaging
Transcript: ENSMUST00000014694
AA Change: Y325H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000014694
Gene: ENSMUSG00000014550
AA Change: Y325H

DomainStartEndE-ValueType
ZnF_C2H2 14 37 4.45e0 SMART
low complexity region 53 64 N/A INTRINSIC
FYVE 148 260 2e-10 SMART
coiled coil region 377 412 N/A INTRINSIC
Pfam:Rbsn 457 498 9e-21 PFAM
low complexity region 512 535 N/A INTRINSIC
Pfam:NPF 547 736 2.3e-61 PFAM
Pfam:Rbsn 737 778 6.5e-16 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000124635
AA Change: Y56H
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204858
Meta Mutation Damage Score 0.3689 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the FYVE zinc finger family of proteins. The encoded protein interacts with Ras-related proteins that regulate membrane trafficking. A missense mutation in this gene is associated with a defect in the early endocytic pathway. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akna T C 4: 63,371,802 D1223G possibly damaging Het
Ankrd42 C A 7: 92,623,978 R147L probably damaging Het
Apopt1 A G 12: 111,724,350 E112G possibly damaging Het
Cep152 T C 2: 125,563,462 I1717V probably benign Het
Clca3a2 A G 3: 144,806,280 probably null Het
Dnhd1 A T 7: 105,710,090 H3544L probably damaging Het
Dpy19l4 T C 4: 11,276,857 probably benign Het
Efcab8 A G 2: 153,783,809 probably null Het
Esyt2 A G 12: 116,367,821 N773S possibly damaging Het
Gm281 A T 14: 13,868,077 I204N probably damaging Het
Hectd4 G A 5: 121,315,437 G613D probably damaging Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Ints3 A G 3: 90,394,094 L827P probably damaging Het
Irf9 T C 14: 55,605,910 probably null Het
Lactb2 T C 1: 13,638,296 D176G probably damaging Het
Lmntd2 A T 7: 141,210,788 S516T possibly damaging Het
Lrp1 C A 10: 127,566,586 A2239S possibly damaging Het
Lrrc56 A G 7: 141,205,563 probably benign Het
Nfic A G 10: 81,406,087 probably null Het
Notch3 G A 17: 32,150,134 probably benign Het
Oas2 T C 5: 120,743,274 K251E probably benign Het
Olfr178 T C 16: 58,890,140 T27A probably benign Het
Pabpc4 T C 4: 123,297,778 probably benign Het
Piwil4 C T 9: 14,736,908 R125H possibly damaging Het
Rhox2e C A X: 37,530,863 P69Q probably damaging Het
Skint6 T C 4: 112,872,457 probably null Het
Tmem165 T C 5: 76,204,824 probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ttc13 A G 8: 124,679,057 V499A probably damaging Het
Vax2 G T 6: 83,711,325 R10L possibly damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Rbsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01417:Rbsn APN 6 92207119 missense possibly damaging 0.82
IGL02073:Rbsn APN 6 92189359 missense probably damaging 1.00
IGL02962:Rbsn APN 6 92190326 missense probably benign 0.00
R0172:Rbsn UTSW 6 92211607 missense probably damaging 0.99
R0735:Rbsn UTSW 6 92189693 missense probably benign 0.01
R0909:Rbsn UTSW 6 92189810 nonsense probably null
R1146:Rbsn UTSW 6 92201730 critical splice donor site probably null
R1146:Rbsn UTSW 6 92201730 critical splice donor site probably null
R1728:Rbsn UTSW 6 92190019 missense possibly damaging 0.69
R1729:Rbsn UTSW 6 92190019 missense possibly damaging 0.69
R1784:Rbsn UTSW 6 92190019 missense possibly damaging 0.69
R2135:Rbsn UTSW 6 92189873 missense probably benign
R2183:Rbsn UTSW 6 92189637 missense probably benign 0.02
R2890:Rbsn UTSW 6 92207123 missense possibly damaging 0.52
R3729:Rbsn UTSW 6 92191335 missense possibly damaging 0.81
R4007:Rbsn UTSW 6 92189819 missense probably benign 0.00
R4356:Rbsn UTSW 6 92207048 missense possibly damaging 0.47
R5027:Rbsn UTSW 6 92198250 missense probably damaging 1.00
R5364:Rbsn UTSW 6 92193977 missense probably damaging 0.96
R5787:Rbsn UTSW 6 92199816 missense possibly damaging 0.81
R7092:Rbsn UTSW 6 92189626 missense probably damaging 1.00
R7134:Rbsn UTSW 6 92201627 missense probably damaging 1.00
R7165:Rbsn UTSW 6 92191334 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CTCGGATTTACACCCTACCCTAAG -3'
(R):5'- TGTCTCCATGAGTCTAAAATGCC -3'

Sequencing Primer
(F):5'- CTACCCTAAGTAGGTGTAACCAG -3'
(R):5'- CTTAGAAATAACCACCTGTCTCTGAG -3'
Posted On2014-10-30