Incidental Mutation 'R2324:Lrrc56'
ID244849
Institutional Source Beutler Lab
Gene Symbol Lrrc56
Ensembl Gene ENSMUSG00000038637
Gene Nameleucine rich repeat containing 56
Synonyms
MMRRC Submission 040315-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R2324 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location141194157-141210055 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 141205563 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026573] [ENSMUST00000047093] [ENSMUST00000070458] [ENSMUST00000084446] [ENSMUST00000170841] [ENSMUST00000209220]
Predicted Effect probably benign
Transcript: ENSMUST00000026573
SMART Domains Protein: ENSMUSP00000026573
Gene: ENSMUSG00000025500

DomainStartEndE-ValueType
coiled coil region 114 170 N/A INTRINSIC
low complexity region 286 298 N/A INTRINSIC
Pfam:LTD 375 482 1.3e-13 PFAM
low complexity region 567 578 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047093
SMART Domains Protein: ENSMUSP00000048691
Gene: ENSMUSG00000038637

DomainStartEndE-ValueType
low complexity region 59 71 N/A INTRINSIC
Pfam:LRR_4 138 177 9.1e-8 PFAM
LRRcap 212 230 4.44e-1 SMART
low complexity region 294 310 N/A INTRINSIC
low complexity region 390 404 N/A INTRINSIC
low complexity region 449 458 N/A INTRINSIC
low complexity region 474 496 N/A INTRINSIC
low complexity region 523 536 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070458
SMART Domains Protein: ENSMUSP00000063912
Gene: ENSMUSG00000038637

DomainStartEndE-ValueType
low complexity region 59 71 N/A INTRINSIC
Pfam:LRR_7 116 132 4e-2 PFAM
Pfam:LRR_8 116 171 8.7e-8 PFAM
Pfam:LRR_4 117 158 7.2e-11 PFAM
Pfam:LRR_1 139 159 2.9e-2 PFAM
LRRcap 212 230 4.44e-1 SMART
low complexity region 294 310 N/A INTRINSIC
low complexity region 390 404 N/A INTRINSIC
low complexity region 449 458 N/A INTRINSIC
low complexity region 474 496 N/A INTRINSIC
low complexity region 523 536 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084446
SMART Domains Protein: ENSMUSP00000081486
Gene: ENSMUSG00000038637

DomainStartEndE-ValueType
low complexity region 59 71 N/A INTRINSIC
Pfam:LRR_7 116 132 3.5e-2 PFAM
Pfam:LRR_8 116 171 6.9e-8 PFAM
Pfam:LRR_4 117 158 6.7e-11 PFAM
Pfam:LRR_6 136 160 5.9e-2 PFAM
Pfam:LRR_1 139 159 2.6e-2 PFAM
Pfam:LRR_6 157 182 4.1e-2 PFAM
Pfam:LRR_1 161 199 5.9e-2 PFAM
LRRcap 212 230 4.44e-1 SMART
low complexity region 294 310 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144199
Predicted Effect probably benign
Transcript: ENSMUST00000170841
SMART Domains Protein: ENSMUSP00000130905
Gene: ENSMUSG00000025500

DomainStartEndE-ValueType
coiled coil region 124 180 N/A INTRINSIC
low complexity region 296 308 N/A INTRINSIC
SCOP:d1ifra_ 385 487 1e-22 SMART
low complexity region 577 588 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209220
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akna T C 4: 63,371,802 D1223G possibly damaging Het
Ankrd42 C A 7: 92,623,978 R147L probably damaging Het
Apopt1 A G 12: 111,724,350 E112G possibly damaging Het
Cep152 T C 2: 125,563,462 I1717V probably benign Het
Clca3a2 A G 3: 144,806,280 probably null Het
Dnhd1 A T 7: 105,710,090 H3544L probably damaging Het
Dpy19l4 T C 4: 11,276,857 probably benign Het
Efcab8 A G 2: 153,783,809 probably null Het
Esyt2 A G 12: 116,367,821 N773S possibly damaging Het
Gm281 A T 14: 13,868,077 I204N probably damaging Het
Hectd4 G A 5: 121,315,437 G613D probably damaging Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Ints3 A G 3: 90,394,094 L827P probably damaging Het
Irf9 T C 14: 55,605,910 probably null Het
Lactb2 T C 1: 13,638,296 D176G probably damaging Het
Lmntd2 A T 7: 141,210,788 S516T possibly damaging Het
Lrp1 C A 10: 127,566,586 A2239S possibly damaging Het
Nfic A G 10: 81,406,087 probably null Het
Notch3 G A 17: 32,150,134 probably benign Het
Oas2 T C 5: 120,743,274 K251E probably benign Het
Olfr178 T C 16: 58,890,140 T27A probably benign Het
Pabpc4 T C 4: 123,297,778 probably benign Het
Piwil4 C T 9: 14,736,908 R125H possibly damaging Het
Rbsn A G 6: 92,193,966 Y325H probably damaging Het
Rhox2e C A X: 37,530,863 P69Q probably damaging Het
Skint6 T C 4: 112,872,457 probably null Het
Tmem165 T C 5: 76,204,824 probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ttc13 A G 8: 124,679,057 V499A probably damaging Het
Vax2 G T 6: 83,711,325 R10L possibly damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Lrrc56
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02619:Lrrc56 APN 7 141207633 unclassified probably benign
IGL02886:Lrrc56 APN 7 141197177 splice site probably benign
IGL03290:Lrrc56 APN 7 141199772 splice site probably benign
IGL03348:Lrrc56 APN 7 141207240 missense probably benign 0.01
R0624:Lrrc56 UTSW 7 141206453 missense probably damaging 1.00
R1333:Lrrc56 UTSW 7 141198264 intron probably benign
R1385:Lrrc56 UTSW 7 141205525 missense probably damaging 1.00
R1857:Lrrc56 UTSW 7 141207508 missense probably benign
R1858:Lrrc56 UTSW 7 141207508 missense probably benign
R1859:Lrrc56 UTSW 7 141207508 missense probably benign
R2234:Lrrc56 UTSW 7 141198294 missense probably damaging 1.00
R3807:Lrrc56 UTSW 7 141209385 missense probably benign
R5347:Lrrc56 UTSW 7 141209624 missense probably benign 0.00
R6194:Lrrc56 UTSW 7 141205651 missense probably damaging 1.00
R7273:Lrrc56 UTSW 7 141209665 missense probably benign
R7500:Lrrc56 UTSW 7 141209530 missense probably benign
R7799:Lrrc56 UTSW 7 141209602 missense probably damaging 1.00
R8097:Lrrc56 UTSW 7 141195906 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGACAGCACTGGATCACTTAC -3'
(R):5'- AGGTCCTCCACATTGTTGC -3'

Sequencing Primer
(F):5'- GTGGAAGTTTGCTCACATCTAAGC -3'
(R):5'- ACATTGTTGCCCTCCAGG -3'
Posted On2014-10-30