Incidental Mutation 'R2324:Nfic'
ID244853
Institutional Source Beutler Lab
Gene Symbol Nfic
Ensembl Gene ENSMUSG00000055053
Gene Namenuclear factor I/C
Synonymsnuclear factor 1-C2, 1110019L22Rik, NF1-C, 1500041O16Rik
MMRRC Submission 040315-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.540) question?
Stock #R2324 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location81396186-81455635 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 81406087 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020461] [ENSMUST00000020461] [ENSMUST00000078185] [ENSMUST00000105321] [ENSMUST00000105321] [ENSMUST00000117966] [ENSMUST00000221817]
Predicted Effect probably null
Transcript: ENSMUST00000020461
SMART Domains Protein: ENSMUSP00000020461
Gene: ENSMUSG00000055053

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 7 47 4.6e-30 PFAM
DWA 68 176 5.77e-24 SMART
Pfam:CTF_NFI 217 428 2e-107 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000020461
SMART Domains Protein: ENSMUSP00000020461
Gene: ENSMUSG00000055053

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 7 47 4.6e-30 PFAM
DWA 68 176 5.77e-24 SMART
Pfam:CTF_NFI 217 428 2e-107 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078185
SMART Domains Protein: ENSMUSP00000077317
Gene: ENSMUSG00000055053

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 4 47 9.5e-31 PFAM
DWA 68 176 5.77e-24 SMART
Pfam:CTF_NFI 217 323 1.4e-52 PFAM
Pfam:CTF_NFI 316 387 1.7e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000105321
SMART Domains Protein: ENSMUSP00000100958
Gene: ENSMUSG00000055053

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 4 47 8e-31 PFAM
DWA 68 176 5.77e-24 SMART
Pfam:CTF_NFI 217 426 5.2e-106 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000105321
SMART Domains Protein: ENSMUSP00000100958
Gene: ENSMUSG00000055053

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 4 47 8e-31 PFAM
DWA 68 176 5.77e-24 SMART
Pfam:CTF_NFI 217 426 5.2e-106 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000117966
SMART Domains Protein: ENSMUSP00000113046
Gene: ENSMUSG00000055053

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 1 38 1.3e-27 PFAM
DWA 59 167 5.77e-24 SMART
Pfam:CTF_NFI 208 421 1.9e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140916
SMART Domains Protein: ENSMUSP00000114469
Gene: ENSMUSG00000055053

DomainStartEndE-ValueType
Pfam:CTF_NFI 1 33 5.9e-12 PFAM
Pfam:CTF_NFI 29 93 1.3e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156260
Predicted Effect probably null
Transcript: ENSMUST00000221817
Meta Mutation Damage Score 0.9498 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the CTF/NF-I family. These are dimeric DNA-binding proteins, and function as cellular transcription factors and as replication factors for adenovirus DNA replication. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted null allele have abnormal incisor and molar root development, show reduced alveolar bone formation, and exhibit impaired feeding leading to severe runting and premature death when reared on standard laboratory chow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akna T C 4: 63,371,802 D1223G possibly damaging Het
Ankrd42 C A 7: 92,623,978 R147L probably damaging Het
Apopt1 A G 12: 111,724,350 E112G possibly damaging Het
Cep152 T C 2: 125,563,462 I1717V probably benign Het
Clca3a2 A G 3: 144,806,280 probably null Het
Dnhd1 A T 7: 105,710,090 H3544L probably damaging Het
Dpy19l4 T C 4: 11,276,857 probably benign Het
Efcab8 A G 2: 153,783,809 probably null Het
Esyt2 A G 12: 116,367,821 N773S possibly damaging Het
Gm281 A T 14: 13,868,077 I204N probably damaging Het
Hectd4 G A 5: 121,315,437 G613D probably damaging Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Ints3 A G 3: 90,394,094 L827P probably damaging Het
Irf9 T C 14: 55,605,910 probably null Het
Lactb2 T C 1: 13,638,296 D176G probably damaging Het
Lmntd2 A T 7: 141,210,788 S516T possibly damaging Het
Lrp1 C A 10: 127,566,586 A2239S possibly damaging Het
Lrrc56 A G 7: 141,205,563 probably benign Het
Notch3 G A 17: 32,150,134 probably benign Het
Oas2 T C 5: 120,743,274 K251E probably benign Het
Olfr178 T C 16: 58,890,140 T27A probably benign Het
Pabpc4 T C 4: 123,297,778 probably benign Het
Piwil4 C T 9: 14,736,908 R125H possibly damaging Het
Rbsn A G 6: 92,193,966 Y325H probably damaging Het
Rhox2e C A X: 37,530,863 P69Q probably damaging Het
Skint6 T C 4: 112,872,457 probably null Het
Tmem165 T C 5: 76,204,824 probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ttc13 A G 8: 124,679,057 V499A probably damaging Het
Vax2 G T 6: 83,711,325 R10L possibly damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Nfic
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Nfic APN 10 81408220 missense possibly damaging 0.94
IGL01486:Nfic APN 10 81407644 splice site probably null
IGL01784:Nfic APN 10 81406148 missense possibly damaging 0.70
IGL02053:Nfic APN 10 81420551 missense probably damaging 1.00
IGL03128:Nfic APN 10 81406191 missense probably benign 0.21
sterb UTSW 10 81420800 critical splice acceptor site probably null
Stronger UTSW 10 81420500 missense probably damaging 1.00
Taller UTSW 10 81406087 critical splice donor site probably null
R0113:Nfic UTSW 10 81420585 missense probably damaging 1.00
R1468:Nfic UTSW 10 81420580 missense probably damaging 1.00
R1468:Nfic UTSW 10 81420580 missense probably damaging 1.00
R1807:Nfic UTSW 10 81404985 missense probably benign 0.21
R1872:Nfic UTSW 10 81420684 missense possibly damaging 0.89
R2295:Nfic UTSW 10 81420531 missense probably damaging 1.00
R5992:Nfic UTSW 10 81420747 missense probably damaging 1.00
R6260:Nfic UTSW 10 81420517 nonsense probably null
R6972:Nfic UTSW 10 81420357 missense probably benign 0.00
R6973:Nfic UTSW 10 81420357 missense probably benign 0.00
R6982:Nfic UTSW 10 81420800 critical splice acceptor site probably null
R7158:Nfic UTSW 10 81420605 missense probably damaging 1.00
R7682:Nfic UTSW 10 81420500 missense probably damaging 1.00
X0065:Nfic UTSW 10 81427098 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGGGCTCTATCAGGATCACAG -3'
(R):5'- CACTTGCTGCCCTTCAGAGATG -3'

Sequencing Primer
(F):5'- CTCTATCAGGATCACAGAGTATGGC -3'
(R):5'- CCCTTCAGAGATGGAGACTTG -3'
Posted On2014-10-30