Incidental Mutation 'R2324:Apopt1'
ID244857
Institutional Source Beutler Lab
Gene Symbol Apopt1
Ensembl Gene ENSMUSG00000037787
Gene Nameapoptogenic, mitochondrial 1
Synonyms1700081D05Rik, 2810002N01Rik, Apop-1
MMRRC Submission 040315-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R2324 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location111713261-111755053 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111724350 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 112 (E112G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040519] [ENSMUST00000159557] [ENSMUST00000162316] [ENSMUST00000163220]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040519
AA Change: E112G

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038865
Gene: ENSMUSG00000037787
AA Change: E112G

DomainStartEndE-ValueType
Pfam:DUF2315 54 182 5.5e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159897
Predicted Effect possibly damaging
Transcript: ENSMUST00000160366
AA Change: E112G

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123929
Gene: ENSMUSG00000037787
AA Change: E112G

DomainStartEndE-ValueType
Pfam:DUF2315 53 162 3.4e-48 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000162316
AA Change: E112G

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125711
Gene: ENSMUSG00000037787
AA Change: E112G

DomainStartEndE-ValueType
Pfam:DUF2315 53 130 7.5e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163220
AA Change: E112G

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131169
Gene: ENSMUSG00000037787
AA Change: E112G

DomainStartEndE-ValueType
Pfam:DUF2315 54 162 3.7e-46 PFAM
Meta Mutation Damage Score 0.2796 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that localizes to the mitochondria, where it stimulates the release of cytochrome c, thereby promoting programmed cell death. Mutations in this gene have been found in individuals with mitochondrial complex IV deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akna T C 4: 63,371,802 D1223G possibly damaging Het
Ankrd42 C A 7: 92,623,978 R147L probably damaging Het
Cep152 T C 2: 125,563,462 I1717V probably benign Het
Clca3a2 A G 3: 144,806,280 probably null Het
Dnhd1 A T 7: 105,710,090 H3544L probably damaging Het
Dpy19l4 T C 4: 11,276,857 probably benign Het
Efcab8 A G 2: 153,783,809 probably null Het
Esyt2 A G 12: 116,367,821 N773S possibly damaging Het
Gm281 A T 14: 13,868,077 I204N probably damaging Het
Hectd4 G A 5: 121,315,437 G613D probably damaging Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Ints3 A G 3: 90,394,094 L827P probably damaging Het
Irf9 T C 14: 55,605,910 probably null Het
Lactb2 T C 1: 13,638,296 D176G probably damaging Het
Lmntd2 A T 7: 141,210,788 S516T possibly damaging Het
Lrp1 C A 10: 127,566,586 A2239S possibly damaging Het
Lrrc56 A G 7: 141,205,563 probably benign Het
Nfic A G 10: 81,406,087 probably null Het
Notch3 G A 17: 32,150,134 probably benign Het
Oas2 T C 5: 120,743,274 K251E probably benign Het
Olfr178 T C 16: 58,890,140 T27A probably benign Het
Pabpc4 T C 4: 123,297,778 probably benign Het
Piwil4 C T 9: 14,736,908 R125H possibly damaging Het
Rbsn A G 6: 92,193,966 Y325H probably damaging Het
Rhox2e C A X: 37,530,863 P69Q probably damaging Het
Skint6 T C 4: 112,872,457 probably null Het
Tmem165 T C 5: 76,204,824 probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ttc13 A G 8: 124,679,057 V499A probably damaging Het
Vax2 G T 6: 83,711,325 R10L possibly damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Apopt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02383:Apopt1 APN 12 111724413 splice site probably benign
R0336:Apopt1 UTSW 12 111733658 intron probably benign
R4436:Apopt1 UTSW 12 111751208 missense probably benign 0.03
R4774:Apopt1 UTSW 12 111713389 missense possibly damaging 0.66
R5161:Apopt1 UTSW 12 111722774 missense possibly damaging 0.55
R5376:Apopt1 UTSW 12 111730058 missense probably damaging 0.96
R5864:Apopt1 UTSW 12 111751218 missense probably benign 0.03
R6802:Apopt1 UTSW 12 111751191 missense probably benign 0.00
R8095:Apopt1 UTSW 12 111722784 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACTGAACATCTTTTAAATTCCTGT -3'
(R):5'- GTCTGCAGGCAGTGGGAC -3'

Sequencing Primer
(F):5'- GTCAGATCTCCACTACAGATGGTTG -3'
(R):5'- AGTGGGACAGTGAGGACAC -3'
Posted On2014-10-30