Incidental Mutation 'R2324:Esyt2'
ID244858
Institutional Source Beutler Lab
Gene Symbol Esyt2
Ensembl Gene ENSMUSG00000021171
Gene Nameextended synaptotagmin-like protein 2
Synonyms4921504I16Rik, D12Ertd551e, 2410017M09Rik, Fam62b
MMRRC Submission 040315-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2324 (G1)
Quality Score152
Status Validated
Chromosome12
Chromosomal Location116281196-116391050 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116367821 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 773 (N773S)
Ref Sequence ENSEMBL: ENSMUSP00000152444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100986] [ENSMUST00000220720] [ENSMUST00000220816]
Predicted Effect possibly damaging
Transcript: ENSMUST00000100986
AA Change: N773S

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000098548
Gene: ENSMUSG00000021171
AA Change: N773S

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
transmembrane domain 51 73 N/A INTRINSIC
Pfam:SMP_LBD 115 294 3e-125 PFAM
C2 310 412 1.39e-14 SMART
C2 461 556 2.59e-14 SMART
low complexity region 660 669 N/A INTRINSIC
C2 726 831 5.51e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220720
Predicted Effect possibly damaging
Transcript: ENSMUST00000220816
AA Change: N773S

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223150
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223181
Meta Mutation Damage Score 0.6462 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (33/33)
MGI Phenotype PHENOTYPE: Mice are viable and fertile without overt morphological defects except reduced FGF-stimulated mouse embryonic fibroblast migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akna T C 4: 63,371,802 D1223G possibly damaging Het
Ankrd42 C A 7: 92,623,978 R147L probably damaging Het
Apopt1 A G 12: 111,724,350 E112G possibly damaging Het
Cep152 T C 2: 125,563,462 I1717V probably benign Het
Clca3a2 A G 3: 144,806,280 probably null Het
Dnhd1 A T 7: 105,710,090 H3544L probably damaging Het
Dpy19l4 T C 4: 11,276,857 probably benign Het
Efcab8 A G 2: 153,783,809 probably null Het
Gm281 A T 14: 13,868,077 I204N probably damaging Het
Hectd4 G A 5: 121,315,437 G613D probably damaging Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Ints3 A G 3: 90,394,094 L827P probably damaging Het
Irf9 T C 14: 55,605,910 probably null Het
Lactb2 T C 1: 13,638,296 D176G probably damaging Het
Lmntd2 A T 7: 141,210,788 S516T possibly damaging Het
Lrp1 C A 10: 127,566,586 A2239S possibly damaging Het
Lrrc56 A G 7: 141,205,563 probably benign Het
Nfic A G 10: 81,406,087 probably null Het
Notch3 G A 17: 32,150,134 probably benign Het
Oas2 T C 5: 120,743,274 K251E probably benign Het
Olfr178 T C 16: 58,890,140 T27A probably benign Het
Pabpc4 T C 4: 123,297,778 probably benign Het
Piwil4 C T 9: 14,736,908 R125H possibly damaging Het
Rbsn A G 6: 92,193,966 Y325H probably damaging Het
Rhox2e C A X: 37,530,863 P69Q probably damaging Het
Skint6 T C 4: 112,872,457 probably null Het
Tmem165 T C 5: 76,204,824 probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ttc13 A G 8: 124,679,057 V499A probably damaging Het
Vax2 G T 6: 83,711,325 R10L possibly damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Esyt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Esyt2 APN 12 116363444 missense probably damaging 1.00
IGL01636:Esyt2 APN 12 116365930 critical splice donor site probably null
IGL01912:Esyt2 APN 12 116339609 missense probably damaging 1.00
IGL02310:Esyt2 APN 12 116365921 missense probably benign 0.06
PIT4802001:Esyt2 UTSW 12 116365837 missense probably benign 0.00
R0134:Esyt2 UTSW 12 116367710 missense probably damaging 0.98
R0225:Esyt2 UTSW 12 116367710 missense probably damaging 0.98
R0313:Esyt2 UTSW 12 116347808 missense probably damaging 1.00
R0532:Esyt2 UTSW 12 116357198 splice site probably benign
R4610:Esyt2 UTSW 12 116318890 missense probably damaging 0.99
R4898:Esyt2 UTSW 12 116342088 missense probably benign 0.06
R4918:Esyt2 UTSW 12 116324140 missense probably benign 0.30
R5052:Esyt2 UTSW 12 116367796 missense probably damaging 1.00
R5222:Esyt2 UTSW 12 116318826 missense probably damaging 1.00
R5800:Esyt2 UTSW 12 116370188 missense possibly damaging 0.94
R6499:Esyt2 UTSW 12 116321170 missense probably damaging 0.98
R6607:Esyt2 UTSW 12 116368740 missense probably benign 0.18
R6951:Esyt2 UTSW 12 116324130 missense probably benign 0.21
R7153:Esyt2 UTSW 12 116346508 missense probably benign 0.00
R7173:Esyt2 UTSW 12 116363534 missense probably benign 0.05
R7227:Esyt2 UTSW 12 116342125 missense probably damaging 1.00
R7248:Esyt2 UTSW 12 116342238 missense probably damaging 1.00
R7509:Esyt2 UTSW 12 116365876 missense probably damaging 1.00
R7780:Esyt2 UTSW 12 116342098 missense probably benign 0.15
R8077:Esyt2 UTSW 12 116342228 missense possibly damaging 0.54
R8136:Esyt2 UTSW 12 116363459 missense probably benign
R8264:Esyt2 UTSW 12 116365920 missense probably benign 0.00
R8350:Esyt2 UTSW 12 116363482 missense probably damaging 0.99
R8450:Esyt2 UTSW 12 116363482 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GATGTGTGTTGCTCCAGATAATATG -3'
(R):5'- CCTCTGCTTGAAGGTCAAAAGC -3'

Sequencing Primer
(F):5'- GTGTTGCTCCAGATAATATGAAGTC -3'
(R):5'- GCTTCTTGACTTATTTAACAAGCGAC -3'
Posted On2014-10-30