Incidental Mutation 'R2324:Irf9'
ID244860
Institutional Source Beutler Lab
Gene Symbol Irf9
Ensembl Gene ENSMUSG00000002325
Gene Nameinterferon regulatory factor 9
Synonymsp48, Isgf3g, Irf-9
MMRRC Submission 040315-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R2324 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location55603571-55610030 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to C at 55605910 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019443] [ENSMUST00000130697] [ENSMUST00000134863] [ENSMUST00000138037]
Predicted Effect probably benign
Transcript: ENSMUST00000019443
SMART Domains Protein: ENSMUSP00000019443
Gene: ENSMUSG00000047098

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Pfam:PUB 68 148 7.1e-17 PFAM
low complexity region 262 294 N/A INTRINSIC
ZnF_RBZ 298 322 2.56e-1 SMART
ZnF_RBZ 346 370 6.93e-5 SMART
ZnF_RBZ 405 429 4.86e-1 SMART
Pfam:HOIP-UBA 477 622 2.4e-54 PFAM
Blast:RING 693 741 7e-25 BLAST
IBR 773 835 3.18e-14 SMART
IBR 847 924 5.35e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126269
Predicted Effect probably null
Transcript: ENSMUST00000130697
SMART Domains Protein: ENSMUSP00000120359
Gene: ENSMUSG00000002325

DomainStartEndE-ValueType
IRF 5 117 1.19e-53 SMART
low complexity region 158 182 N/A INTRINSIC
low complexity region 185 194 N/A INTRINSIC
IRF-3 211 377 1.13e-59 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133903
Predicted Effect probably null
Transcript: ENSMUST00000134863
SMART Domains Protein: ENSMUSP00000120525
Gene: ENSMUSG00000002325

DomainStartEndE-ValueType
low complexity region 34 58 N/A INTRINSIC
IRF 71 183 1.19e-53 SMART
low complexity region 224 248 N/A INTRINSIC
low complexity region 251 260 N/A INTRINSIC
IRF-3 277 443 1.13e-59 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136109
Predicted Effect probably null
Transcript: ENSMUST00000138037
SMART Domains Protein: ENSMUSP00000119477
Gene: ENSMUSG00000002325

DomainStartEndE-ValueType
IRF 23 135 1.19e-53 SMART
low complexity region 176 200 N/A INTRINSIC
low complexity region 203 212 N/A INTRINSIC
IRF-3 229 395 1.13e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140178
SMART Domains Protein: ENSMUSP00000118215
Gene: ENSMUSG00000047098

DomainStartEndE-ValueType
PDB:4OYJ|M 2 85 1e-29 PDB
low complexity region 164 196 N/A INTRINSIC
ZnF_RBZ 200 224 2.56e-1 SMART
ZnF_RBZ 248 272 6.93e-5 SMART
ZnF_RBZ 307 331 4.86e-1 SMART
Pfam:HOIP-UBA 369 468 1.1e-31 PFAM
Blast:RING 539 587 9e-25 BLAST
IBR 619 681 3.18e-14 SMART
IBR 693 770 5.35e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145680
Predicted Effect probably benign
Transcript: ENSMUST00000226275
Predicted Effect probably benign
Transcript: ENSMUST00000227708
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (33/33)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display an apparently normal phenotype. However, antivirus response induced by Ifn alfpha and Ifn gamma are impaired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akna T C 4: 63,371,802 D1223G possibly damaging Het
Ankrd42 C A 7: 92,623,978 R147L probably damaging Het
Apopt1 A G 12: 111,724,350 E112G possibly damaging Het
Cep152 T C 2: 125,563,462 I1717V probably benign Het
Clca3a2 A G 3: 144,806,280 probably null Het
Dnhd1 A T 7: 105,710,090 H3544L probably damaging Het
Dpy19l4 T C 4: 11,276,857 probably benign Het
Efcab8 A G 2: 153,783,809 probably null Het
Esyt2 A G 12: 116,367,821 N773S possibly damaging Het
Gm281 A T 14: 13,868,077 I204N probably damaging Het
Hectd4 G A 5: 121,315,437 G613D probably damaging Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Ints3 A G 3: 90,394,094 L827P probably damaging Het
Lactb2 T C 1: 13,638,296 D176G probably damaging Het
Lmntd2 A T 7: 141,210,788 S516T possibly damaging Het
Lrp1 C A 10: 127,566,586 A2239S possibly damaging Het
Lrrc56 A G 7: 141,205,563 probably benign Het
Nfic A G 10: 81,406,087 probably null Het
Notch3 G A 17: 32,150,134 probably benign Het
Oas2 T C 5: 120,743,274 K251E probably benign Het
Olfr178 T C 16: 58,890,140 T27A probably benign Het
Pabpc4 T C 4: 123,297,778 probably benign Het
Piwil4 C T 9: 14,736,908 R125H possibly damaging Het
Rbsn A G 6: 92,193,966 Y325H probably damaging Het
Rhox2e C A X: 37,530,863 P69Q probably damaging Het
Skint6 T C 4: 112,872,457 probably null Het
Tmem165 T C 5: 76,204,824 probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ttc13 A G 8: 124,679,057 V499A probably damaging Het
Vax2 G T 6: 83,711,325 R10L possibly damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Irf9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Irf9 APN 14 55607601 missense probably damaging 0.98
IGL02283:Irf9 APN 14 55607739 missense probably damaging 1.00
IGL02317:Irf9 APN 14 55607739 missense probably damaging 1.00
IGL02407:Irf9 APN 14 55605221 missense possibly damaging 0.92
Long_lost UTSW 14 55605910 splice site probably null
R0233:Irf9 UTSW 14 55606094 missense probably benign 0.00
R0233:Irf9 UTSW 14 55606094 missense probably benign 0.00
R1959:Irf9 UTSW 14 55607717 missense possibly damaging 0.93
R4669:Irf9 UTSW 14 55605766 missense probably benign
R4882:Irf9 UTSW 14 55609039 utr 3 prime probably benign
R5393:Irf9 UTSW 14 55606457 unclassified probably benign
R6072:Irf9 UTSW 14 55605827 missense probably damaging 1.00
R6277:Irf9 UTSW 14 55607652 missense probably benign 0.04
R6337:Irf9 UTSW 14 55606342 missense possibly damaging 0.62
R6545:Irf9 UTSW 14 55605227 missense probably damaging 1.00
R6993:Irf9 UTSW 14 55608957 missense probably benign 0.06
R7956:Irf9 UTSW 14 55609024 missense probably benign 0.00
R8145:Irf9 UTSW 14 55605798 nonsense probably null
R8326:Irf9 UTSW 14 55605753 missense probably benign 0.02
RF014:Irf9 UTSW 14 55605877 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGCTTGGGCACTGTTTAAG -3'
(R):5'- ACTTCGCTTGCATGGTGATTTC -3'

Sequencing Primer
(F):5'- CTTGGGCACTGTTTAAGGAAAAGC -3'
(R):5'- CTGTGGAAATGTTGCAGGCAG -3'
Posted On2014-10-30