Incidental Mutation 'R2324:Olfr178'
ID244861
Institutional Source Beutler Lab
Gene Symbol Olfr178
Ensembl Gene ENSMUSG00000044029
Gene Nameolfactory receptor 178
SynonymsGA_x54KRFPKG5P-55108059-55107100, MOR184-6
MMRRC Submission 040315-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R2324 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location58888308-58892063 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58890140 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 27 (T27A)
Ref Sequence ENSEMBL: ENSMUSP00000148922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058564] [ENSMUST00000206523] [ENSMUST00000215032]
Predicted Effect probably benign
Transcript: ENSMUST00000058564
AA Change: T27A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000049578
Gene: ENSMUSG00000044029
AA Change: T27A

DomainStartEndE-ValueType
Pfam:7tm_4 33 306 1.2e-49 PFAM
Pfam:7TM_GPCR_Srsx 37 262 4.4e-7 PFAM
Pfam:7tm_1 43 312 5.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206523
AA Change: T27A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215032
AA Change: T27A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0935 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akna T C 4: 63,371,802 D1223G possibly damaging Het
Ankrd42 C A 7: 92,623,978 R147L probably damaging Het
Apopt1 A G 12: 111,724,350 E112G possibly damaging Het
Cep152 T C 2: 125,563,462 I1717V probably benign Het
Clca3a2 A G 3: 144,806,280 probably null Het
Dnhd1 A T 7: 105,710,090 H3544L probably damaging Het
Dpy19l4 T C 4: 11,276,857 probably benign Het
Efcab8 A G 2: 153,783,809 probably null Het
Esyt2 A G 12: 116,367,821 N773S possibly damaging Het
Gm281 A T 14: 13,868,077 I204N probably damaging Het
Hectd4 G A 5: 121,315,437 G613D probably damaging Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Ints3 A G 3: 90,394,094 L827P probably damaging Het
Irf9 T C 14: 55,605,910 probably null Het
Lactb2 T C 1: 13,638,296 D176G probably damaging Het
Lmntd2 A T 7: 141,210,788 S516T possibly damaging Het
Lrp1 C A 10: 127,566,586 A2239S possibly damaging Het
Lrrc56 A G 7: 141,205,563 probably benign Het
Nfic A G 10: 81,406,087 probably null Het
Notch3 G A 17: 32,150,134 probably benign Het
Oas2 T C 5: 120,743,274 K251E probably benign Het
Pabpc4 T C 4: 123,297,778 probably benign Het
Piwil4 C T 9: 14,736,908 R125H possibly damaging Het
Rbsn A G 6: 92,193,966 Y325H probably damaging Het
Rhox2e C A X: 37,530,863 P69Q probably damaging Het
Skint6 T C 4: 112,872,457 probably null Het
Tmem165 T C 5: 76,204,824 probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ttc13 A G 8: 124,679,057 V499A probably damaging Het
Vax2 G T 6: 83,711,325 R10L possibly damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Olfr178
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Olfr178 APN 16 58889685 missense probably damaging 0.97
IGL01964:Olfr178 APN 16 58889464 missense probably damaging 0.97
IGL02122:Olfr178 APN 16 58889771 missense probably benign
IGL02183:Olfr178 APN 16 58889821 missense probably benign 0.00
IGL03143:Olfr178 APN 16 58889461 missense probably damaging 1.00
R1566:Olfr178 UTSW 16 58889540 missense probably damaging 1.00
R2420:Olfr178 UTSW 16 58889965 missense probably benign 0.00
R2421:Olfr178 UTSW 16 58889965 missense probably benign 0.00
R2422:Olfr178 UTSW 16 58889965 missense probably benign 0.00
R4256:Olfr178 UTSW 16 58889780 missense probably benign 0.21
R4374:Olfr178 UTSW 16 58889879 missense probably benign 0.13
R4502:Olfr178 UTSW 16 58890176 missense probably benign 0.02
R4503:Olfr178 UTSW 16 58890176 missense probably benign 0.02
R4662:Olfr178 UTSW 16 58889924 missense probably damaging 1.00
R4967:Olfr178 UTSW 16 58889594 missense possibly damaging 0.48
R5206:Olfr178 UTSW 16 58890018 missense probably damaging 0.99
R5285:Olfr178 UTSW 16 58890108 nonsense probably null
R5477:Olfr178 UTSW 16 58889744 missense probably benign 0.10
R5554:Olfr178 UTSW 16 58889806 missense possibly damaging 0.95
R5723:Olfr178 UTSW 16 58889613 nonsense probably null
R5725:Olfr178 UTSW 16 58889887 missense possibly damaging 0.64
R6853:Olfr178 UTSW 16 58889758 missense possibly damaging 0.64
R6853:Olfr178 UTSW 16 58889759 missense probably damaging 0.99
R7238:Olfr178 UTSW 16 58889889 missense probably damaging 1.00
R7554:Olfr178 UTSW 16 58889406 missense probably benign 0.27
R7577:Olfr178 UTSW 16 58889266 missense probably benign 0.22
R7787:Olfr178 UTSW 16 58889590 missense probably benign
R8008:Olfr178 UTSW 16 58889888 missense probably benign 0.13
R8140:Olfr178 UTSW 16 58889585 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GAACTGTGCCATGCATTCATAGAG -3'
(R):5'- GCCATACCTGTTCCTGCAAC -3'

Sequencing Primer
(F):5'- AAGAAGTTCTCTAGCATCTTGGGAG -3'
(R):5'- CTGTTCCTGCAACTAGAGCTAGAG -3'
Posted On2014-10-30