Incidental Mutation 'R2325:Zc3h15'
ID244869
Institutional Source Beutler Lab
Gene Symbol Zc3h15
Ensembl Gene ENSMUSG00000027091
Gene Namezinc finger CCCH-type containing 15
Synonyms2610312B22Rik, FM22, Ierepo4, 1700006A17Rik, 1810012H02Rik
MMRRC Submission 040316-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.711) question?
Stock #R2325 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location83644435-83664622 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 83653439 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 53 (G53S)
Ref Sequence ENSEMBL: ENSMUSP00000080301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081591]
Predicted Effect probably damaging
Transcript: ENSMUST00000081591
AA Change: G53S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080301
Gene: ENSMUSG00000027091
AA Change: G53S

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
coiled coil region 60 86 N/A INTRINSIC
ZnF_C3H1 99 125 7.84e-8 SMART
ZnF_C3H1 175 211 3.81e0 SMART
Pfam:DFRP_C 229 336 4.2e-23 PFAM
low complexity region 410 426 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130948
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140086
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142756
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145099
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 T C 13: 4,523,296 T7A probably benign Het
Atoh7 C A 10: 63,100,145 probably benign Het
Atp2b1 C T 10: 99,018,895 Q219* probably null Het
B3galt2 A G 1: 143,647,188 D354G probably benign Het
Cdh9 A G 15: 16,778,200 R34G probably benign Het
Cyp4x1 A T 4: 115,124,379 C126S probably benign Het
Dse A T 10: 34,184,047 S21T probably benign Het
Ell2 T A 13: 75,769,626 H558Q probably damaging Het
Esco2 A T 14: 65,826,578 probably null Het
Fam170a A G 18: 50,281,850 K188E possibly damaging Het
Gin1 A C 1: 97,792,561 Y516S probably damaging Het
Gm8439 A G 4: 120,588,851 E16G unknown Het
Gtf2b A G 3: 142,780,090 T176A probably damaging Het
Ikbkap A T 4: 56,784,622 M457K probably benign Het
Kcnh6 C T 11: 106,033,835 S822F probably benign Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lrp8 A T 4: 107,864,009 D602V probably benign Het
Med12l A G 3: 59,232,454 T817A probably damaging Het
Mroh9 A C 1: 163,026,530 probably null Het
N4bp1 T C 8: 86,848,460 I736V probably damaging Het
Nebl T C 2: 17,393,016 K490E possibly damaging Het
P2ry1 A T 3: 61,003,578 K46M probably damaging Het
Ppp1r37 A T 7: 19,532,684 L426H probably damaging Het
Prkci T A 3: 31,031,068 probably null Het
Prss35 G A 9: 86,756,304 G376R probably damaging Het
Scube2 C G 7: 109,843,954 C226S probably damaging Het
Slc26a5 T G 5: 21,819,694 Y469S probably damaging Het
Stil T A 4: 115,032,707 D797E probably benign Het
Thbs2 A T 17: 14,690,289 probably null Het
Tmem132e C A 11: 82,434,515 L114M probably damaging Het
Tmem161b C A 13: 84,294,768 T269K possibly damaging Het
Vmn1r173 T A 7: 23,703,112 C257* probably null Het
Zfp462 A C 4: 55,013,712 I1893L probably benign Het
Other mutations in Zc3h15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01619:Zc3h15 APN 2 83660173 missense probably damaging 1.00
IGL01688:Zc3h15 APN 2 83662192 missense probably damaging 0.99
IGL01951:Zc3h15 APN 2 83661485 missense probably damaging 1.00
IGL02514:Zc3h15 APN 2 83653381 missense probably damaging 1.00
IGL02852:Zc3h15 APN 2 83644671 missense possibly damaging 0.85
IGL03075:Zc3h15 APN 2 83662191 missense possibly damaging 0.95
IGL03055:Zc3h15 UTSW 2 83661171 missense possibly damaging 0.90
R0117:Zc3h15 UTSW 2 83658083 missense possibly damaging 0.51
R0465:Zc3h15 UTSW 2 83663815 splice site probably benign
R1711:Zc3h15 UTSW 2 83661148 missense probably benign 0.03
R1861:Zc3h15 UTSW 2 83663990 missense unknown
R2258:Zc3h15 UTSW 2 83657016 missense probably benign 0.00
R4152:Zc3h15 UTSW 2 83658569 missense probably benign 0.06
R4154:Zc3h15 UTSW 2 83658569 missense probably benign 0.06
R4420:Zc3h15 UTSW 2 83658012 missense probably damaging 0.97
R5384:Zc3h15 UTSW 2 83660230 missense possibly damaging 0.55
R6341:Zc3h15 UTSW 2 83661223 missense probably benign 0.11
R6544:Zc3h15 UTSW 2 83661148 missense probably benign 0.03
R6923:Zc3h15 UTSW 2 83657056 missense possibly damaging 0.68
R7770:Zc3h15 UTSW 2 83658132 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- TCTGAAGACAGCTACAGTGTACTTTAC -3'
(R):5'- GCTTGGAGAACTGTCTGAGAG -3'

Sequencing Primer
(F):5'- ACTAAGATTTGTGTATGTCGTT -3'
(R):5'- GAACTGTCTGAGAGGTACTGC -3'
Posted On2014-10-30