Incidental Mutation 'R2325:Esco2'
ID244898
Institutional Source Beutler Lab
Gene Symbol Esco2
Ensembl Gene ENSMUSG00000022034
Gene Nameestablishment of sister chromatid cohesion N-acetyltransferase 2
Synonyms
MMRRC Submission 040316-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2325 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location65819038-65833994 bp(-) (GRCm38)
Type of Mutationsplice site (4848 bp from exon)
DNA Base Change (assembly) A to T at 65826578 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022613] [ENSMUST00000225853]
Predicted Effect probably damaging
Transcript: ENSMUST00000022613
AA Change: C386S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022613
Gene: ENSMUSG00000022034
AA Change: C386S

DomainStartEndE-ValueType
low complexity region 139 156 N/A INTRINSIC
low complexity region 229 243 N/A INTRINSIC
Pfam:zf-C2H2_3 371 410 1.6e-18 PFAM
Pfam:Acetyltransf_13 520 588 2e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136920
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224162
Predicted Effect probably null
Transcript: ENSMUST00000225853
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may have acetyltransferase activity and may be required for the establishment of sister chromatid cohesion during the S phase of mitosis. Mutations in this gene have been associated with Roberts syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality before implantation associated with impaired chromosome cohesion and abnormal mitosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c20 T C 13: 4,523,296 T7A probably benign Het
Atoh7 C A 10: 63,100,145 probably benign Het
Atp2b1 C T 10: 99,018,895 Q219* probably null Het
B3galt2 A G 1: 143,647,188 D354G probably benign Het
Cdh9 A G 15: 16,778,200 R34G probably benign Het
Cyp4x1 A T 4: 115,124,379 C126S probably benign Het
Dse A T 10: 34,184,047 S21T probably benign Het
Ell2 T A 13: 75,769,626 H558Q probably damaging Het
Fam170a A G 18: 50,281,850 K188E possibly damaging Het
Gin1 A C 1: 97,792,561 Y516S probably damaging Het
Gm8439 A G 4: 120,588,851 E16G unknown Het
Gtf2b A G 3: 142,780,090 T176A probably damaging Het
Ikbkap A T 4: 56,784,622 M457K probably benign Het
Kcnh6 C T 11: 106,033,835 S822F probably benign Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lrp8 A T 4: 107,864,009 D602V probably benign Het
Med12l A G 3: 59,232,454 T817A probably damaging Het
Mroh9 A C 1: 163,026,530 probably null Het
N4bp1 T C 8: 86,848,460 I736V probably damaging Het
Nebl T C 2: 17,393,016 K490E possibly damaging Het
P2ry1 A T 3: 61,003,578 K46M probably damaging Het
Ppp1r37 A T 7: 19,532,684 L426H probably damaging Het
Prkci T A 3: 31,031,068 probably null Het
Prss35 G A 9: 86,756,304 G376R probably damaging Het
Scube2 C G 7: 109,843,954 C226S probably damaging Het
Slc26a5 T G 5: 21,819,694 Y469S probably damaging Het
Stil T A 4: 115,032,707 D797E probably benign Het
Thbs2 A T 17: 14,690,289 probably null Het
Tmem132e C A 11: 82,434,515 L114M probably damaging Het
Tmem161b C A 13: 84,294,768 T269K possibly damaging Het
Vmn1r173 T A 7: 23,703,112 C257* probably null Het
Zc3h15 G A 2: 83,653,439 G53S probably damaging Het
Zfp462 A C 4: 55,013,712 I1893L probably benign Het
Other mutations in Esco2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01569:Esco2 APN 14 65826528 missense probably benign 0.00
IGL01613:Esco2 APN 14 65826595 missense possibly damaging 0.75
IGL02148:Esco2 APN 14 65826595 missense probably benign 0.00
IGL03039:Esco2 APN 14 65831418 missense probably damaging 0.97
PIT4508001:Esco2 UTSW 14 65831465 missense probably damaging 0.99
R0400:Esco2 UTSW 14 65831706 missense possibly damaging 0.73
R0894:Esco2 UTSW 14 65827277 missense probably benign 0.35
R1778:Esco2 UTSW 14 65831262 missense possibly damaging 0.47
R1795:Esco2 UTSW 14 65827277 missense probably benign 0.35
R1962:Esco2 UTSW 14 65831533 missense probably damaging 1.00
R2357:Esco2 UTSW 14 65826551 missense probably benign 0.32
R2369:Esco2 UTSW 14 65821740 missense probably damaging 1.00
R4659:Esco2 UTSW 14 65826586 missense possibly damaging 0.92
R5648:Esco2 UTSW 14 65831192 missense probably damaging 1.00
R5873:Esco2 UTSW 14 65824191 missense probably benign 0.00
R6782:Esco2 UTSW 14 65820016 missense probably benign 0.00
R6877:Esco2 UTSW 14 65831045 missense probably benign 0.01
R7116:Esco2 UTSW 14 65826557 missense probably damaging 1.00
R7572:Esco2 UTSW 14 65831192 missense probably damaging 0.97
R7645:Esco2 UTSW 14 65827181 missense probably benign 0.08
R8055:Esco2 UTSW 14 65831719 missense probably benign 0.20
R8072:Esco2 UTSW 14 65832681 missense probably benign
R8483:Esco2 UTSW 14 65831669 missense probably benign 0.00
Z1177:Esco2 UTSW 14 65824936 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CTACAGCCTAATACAGTTCCTCATG -3'
(R):5'- CCTTCTGTTTGAAATGAGGCCTTG -3'

Sequencing Primer
(F):5'- TTCCTAACTGCTGGGATCACAGG -3'
(R):5'- GAAATGAGGCCTTGTCTGTTTC -3'
Posted On2014-10-30