Mutagenetix > Incidental Mutation

Incidental Mutation 'R0278:Wapl'

24490

Institutional Source

Beutler Lab

Gene Symbol

Wapl

Ensembl Gene

ENSMUSG00000041408

Gene Name

WAPL cohesin release factor

Synonyms

A530089A20Rik, Wapal

MMRRC Submission

038500-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0278 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

34673928-34747983 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 34692612 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 477 (D477G)

Ref Sequence

ENSEMBL: ENSMUSP00000130547 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048263] [ENSMUST00000090027] [ENSMUST00000169910]

AlphaFold

Q65Z40

Predicted Effect

possibly damaging
Transcript: ENSMUST00000048263
AA Change: D477G

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000040232
Gene: ENSMUSG00000041408
AA Change: D477G

Domain	Start	End	E-Value	Type
low complexity region	436	455	N/A	INTRINSIC
low complexity region	465	477	N/A	INTRINSIC
low complexity region	493	513	N/A	INTRINSIC
Pfam:WAPL	645	1009	6.5e-153	PFAM
low complexity region	1018	1033	N/A	INTRINSIC
low complexity region	1101	1112	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000090027
AA Change: D477G

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000087481
Gene: ENSMUSG00000041408
AA Change: D477G

Domain	Start	End	E-Value	Type
low complexity region	436	455	N/A	INTRINSIC
low complexity region	465	477	N/A	INTRINSIC
low complexity region	493	513	N/A	INTRINSIC
Pfam:WAPL	639	1003	2.6e-153	PFAM
low complexity region	1012	1027	N/A	INTRINSIC
low complexity region	1095	1106	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000111895

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169910
AA Change: D477G

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000130547
Gene: ENSMUSG00000041408
AA Change: D477G

Domain	Start	End	E-Value	Type
low complexity region	436	455	N/A	INTRINSIC
low complexity region	465	477	N/A	INTRINSIC
low complexity region	493	513	N/A	INTRINSIC
Pfam:WAPL	647	1008	3.5e-120	PFAM
low complexity region	1018	1033	N/A	INTRINSIC
low complexity region	1101	1112	N/A	INTRINSIC

Coding Region Coverage

1x: 98.8%
3x: 97.8%
10x: 95.4%
20x: 90.7%

Validation Efficiency

MGI Phenotype

FUNCTION: Studies suggest that the protein encoded by this gene is important for the release of cohesin from chromatin. This gene product is thought to be essential for development, and reduced expression of this gene in cells causes defects in chromatin structure. High levels of expression of the human ortholog of this gene are observed in cervical cancers, and expression of the human ortholog of this gene in mice results in tumor formation. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	A	11: 9,378,215	S3429R	probably damaging	Het
Abca3	A	G	17: 24,381,920	D436G	probably benign	Het
Acacb	C	A	5: 114,233,259	Y1816*	probably null	Het
Acer3	T	C	7: 98,261,597	Y86C	probably damaging	Het
Adgre1	A	G	17: 57,447,872	I657V	probably benign	Het
Akap1	A	G	11: 88,845,194	V214A	probably benign	Het
Ankrd42	T	C	7: 92,631,657	R22G	possibly damaging	Het
Apc2	C	T	10: 80,312,813	P1234S	possibly damaging	Het
Atp13a4	A	G	16: 29,454,834	I441T	probably damaging	Het
Cenpu	G	A	8: 46,578,309	A242T	probably damaging	Het
Col6a6	A	T	9: 105,767,288	V1267E	possibly damaging	Het
Crhr2	T	C	6: 55,117,531	T58A	probably benign	Het
Ddx6	T	G	9: 44,631,425	C385G	probably damaging	Het
Dnah7a	A	T	1: 53,504,146	N2288K	probably benign	Het
Egfl8	A	T	17: 34,614,368		probably null	Het
Elmo2	A	T	2: 165,297,367	I420N	probably damaging	Het
Elovl4	A	G	9: 83,783,195	F113L	probably benign	Het
Fancd2	T	A	6: 113,548,448		probably null	Het
Fbxl13	A	G	5: 21,523,910	V456A	probably benign	Het
Fgfr2	A	T	7: 130,261,862		probably null	Het
Fkbpl	A	T	17: 34,645,410	R51*	probably null	Het
Fn3krp	G	A	11: 121,421,580	V40M	probably damaging	Het
Fnip1	A	G	11: 54,489,343		probably null	Het
Gm15446	A	T	5: 109,943,415	Q511L	probably benign	Het
Gm7334	A	G	17: 50,699,261	K192E	probably damaging	Het
H2-Q10	A	T	17: 35,473,307	T282S	possibly damaging	Het
Hspa9	A	G	18: 34,940,910	V482A	possibly damaging	Het
Ica1l	A	T	1: 60,013,996	S128T	probably benign	Het
Il7r	A	T	15: 9,516,337	I126K	probably damaging	Het
Kcnj8	T	C	6: 142,570,348	E11G	probably benign	Het
Klkb1	A	C	8: 45,272,409	F498V	probably benign	Het
Lama1	A	G	17: 67,810,183	E2491G	probably null	Het
Lhfpl2	T	C	13: 94,174,435	V71A	probably benign	Het
Lin9	T	C	1: 180,665,923	I198T	probably damaging	Het
Lrrc7	T	A	3: 158,179,795	M431L	possibly damaging	Het
Nmt2	A	G	2: 3,325,387	T519A	probably benign	Het
Olfr1043	A	T	2: 86,162,579	Y123*	probably null	Het
Olfr1247	A	T	2: 89,609,763	L113Q	probably damaging	Het
Olfr1247	G	T	2: 89,609,764	L113M	probably damaging	Het
Olfr1490	C	A	19: 13,654,764	L112I	probably damaging	Het
Olfr1490	T	A	19: 13,654,765	L112H	probably damaging	Het
Olfr412	T	C	11: 74,365,202	F178L	probably damaging	Het
Olfr871	G	T	9: 20,212,886	C179F	probably damaging	Het
Parp4	A	G	14: 56,607,523	R624G	probably damaging	Het
Pex16	C	T	2: 92,381,056	P325S	probably damaging	Het
Pik3ca	T	C	3: 32,439,753	M288T	possibly damaging	Het
Pla2g5	C	T	4: 138,800,656	D100N	probably benign	Het
Prss43	T	A	9: 110,827,362	M39K	probably benign	Het
Psd4	T	C	2: 24,394,438	S105P	probably damaging	Het
Ptprz1	T	A	6: 23,000,817	S969T	probably benign	Het
Rad23b	T	A	4: 55,383,575		probably null	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rpl10l	A	G	12: 66,284,356	M1T	probably null	Het
Sec16a	A	G	2: 26,428,316	S1588P	probably damaging	Het
Sh3rf1	A	T	8: 61,374,018	H602L	probably damaging	Het
Sparcl1	A	T	5: 104,088,397	S497T	probably benign	Het
Spata13	A	G	14: 60,692,088	Y365C	probably benign	Het
Trim5	T	C	7: 104,279,675	N20D	probably benign	Het
Vmn1r201	G	T	13: 22,475,024	W136L	probably damaging	Het
Vmn2r112	A	G	17: 22,603,006	I222V	probably benign	Het
Vmn2r56	A	T	7: 12,715,717	V198D	probably damaging	Het
Zfp202	C	A	9: 40,208,482	H194N	probably benign	Het
Zfp212	C	T	6: 47,926,519	R13W	probably damaging	Het

Other mutations in Wapl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00335:Wapl	APN	14	34692636	missense	probably benign	0.00
IGL00539:Wapl	APN	14	34695008	missense	probably damaging	1.00
IGL00846:Wapl	APN	14	34692744	splice site	probably benign
IGL01070:Wapl	APN	14	34745622	unclassified	probably benign
IGL01516:Wapl	APN	14	34692081	missense	probably damaging	1.00
IGL02021:Wapl	APN	14	34722336	missense	probably benign
IGL02209:Wapl	APN	14	34677261	missense	possibly damaging	0.46
IGL02309:Wapl	APN	14	34744863	missense	probably damaging	0.98
IGL02471:Wapl	APN	14	34691920	missense	possibly damaging	0.68
IGL02965:Wapl	APN	14	34739224	intron	probably benign
IGL03076:Wapl	APN	14	34692089	missense	probably benign	0.26
IGL03197:Wapl	APN	14	34745631	missense	possibly damaging	0.77
Mcclintock	UTSW	14	34730662	critical splice donor site	probably null
Tatum	UTSW	14	34729195	missense	probably damaging	1.00
R0045:Wapl	UTSW	14	34733794	missense	probably benign	0.18
R0335:Wapl	UTSW	14	34692324	missense	probably damaging	0.99
R1018:Wapl	UTSW	14	34691906	missense	possibly damaging	0.91
R1295:Wapl	UTSW	14	34724769	missense	probably damaging	1.00
R1553:Wapl	UTSW	14	34729190	missense	probably damaging	1.00
R1868:Wapl	UTSW	14	34692458	missense	probably benign	0.00
R1909:Wapl	UTSW	14	34691912	missense	probably damaging	1.00
R2698:Wapl	UTSW	14	34691777	missense	probably benign
R2990:Wapl	UTSW	14	34736708	missense	probably damaging	0.98
R3121:Wapl	UTSW	14	34729215	missense	possibly damaging	0.93
R3122:Wapl	UTSW	14	34729215	missense	possibly damaging	0.93
R3147:Wapl	UTSW	14	34725149	missense	probably damaging	1.00
R3732:Wapl	UTSW	14	34736764	missense	probably damaging	0.99
R3732:Wapl	UTSW	14	34736764	missense	probably damaging	0.99
R3733:Wapl	UTSW	14	34736764	missense	probably damaging	0.99
R3878:Wapl	UTSW	14	34692147	missense	probably damaging	1.00
R4034:Wapl	UTSW	14	34737914	missense	possibly damaging	0.92
R4934:Wapl	UTSW	14	34692095	missense	probably benign	0.11
R5079:Wapl	UTSW	14	34724757	missense	probably damaging	1.00
R5104:Wapl	UTSW	14	34692059	nonsense	probably null
R5113:Wapl	UTSW	14	34724754	missense	probably damaging	1.00
R5121:Wapl	UTSW	14	34677162	missense	probably benign	0.01
R5222:Wapl	UTSW	14	34736685	nonsense	probably null
R5299:Wapl	UTSW	14	34733808	critical splice donor site	probably null
R5387:Wapl	UTSW	14	34677295	missense	probably benign	0.00
R5541:Wapl	UTSW	14	34730662	critical splice donor site	probably null
R5618:Wapl	UTSW	14	34691906	missense	possibly damaging	0.91
R5802:Wapl	UTSW	14	34692320	missense	probably damaging	1.00
R6029:Wapl	UTSW	14	34739247	missense	possibly damaging	0.94
R6292:Wapl	UTSW	14	34729195	missense	probably damaging	1.00
R6482:Wapl	UTSW	14	34692692	missense	probably benign	0.01
R6487:Wapl	UTSW	14	34692292	missense	probably damaging	1.00
R6925:Wapl	UTSW	14	34677363	missense	probably benign	0.31
R6937:Wapl	UTSW	14	34722354	missense	probably benign	0.01
R7080:Wapl	UTSW	14	34692356	missense	probably benign	0.03
R7203:Wapl	UTSW	14	34736691	missense	probably benign
R7944:Wapl	UTSW	14	34677148	missense	probably benign	0.00
R7945:Wapl	UTSW	14	34677148	missense	probably benign	0.00
R7969:Wapl	UTSW	14	34730647	missense	probably damaging	1.00
R8038:Wapl	UTSW	14	34691682	missense	probably benign
R8053:Wapl	UTSW	14	34692321	missense	probably damaging	1.00
R8688:Wapl	UTSW	14	34692592	missense	possibly damaging	0.94
R8864:Wapl	UTSW	14	34692202	missense	probably benign	0.03
R8988:Wapl	UTSW	14	34729182	missense	probably damaging	1.00
R9072:Wapl	UTSW	14	34677460	missense	possibly damaging	0.81
R9197:Wapl	UTSW	14	34722287	missense	probably damaging	1.00
R9259:Wapl	UTSW	14	34741095	missense	probably benign	0.00
R9545:Wapl	UTSW	14	34677093	missense	probably damaging	1.00
R9613:Wapl	UTSW	14	34731563	missense	probably benign	0.29
R9624:Wapl	UTSW	14	34692106	missense	possibly damaging	0.89
Z1177:Wapl	UTSW	14	34745690	makesense	probably null

Predicted Primers

PCR Primer
(F):5'- AGGCAGATATTGCAACCTCCAAGAC -3'
(R):5'- TGCATATAGCCACATGCAGGCAC -3'

Sequencing Primer
(F):5'- TCCAAGACCACTACTAGATTTCG -3'
(R):5'- TGGAATATTTAGGAAAGAGCCTACCC -3'

Posted On

2013-04-16