Incidental Mutation 'R2326:Rassf2'
ID244904
Institutional Source Beutler Lab
Gene Symbol Rassf2
Ensembl Gene ENSMUSG00000027339
Gene NameRas association (RalGDS/AF-6) domain family member 2
Synonyms
MMRRC Submission 040317-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R2326 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location131989415-132030258 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 132000432 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028814] [ENSMUST00000103182] [ENSMUST00000139047]
Predicted Effect probably null
Transcript: ENSMUST00000028814
SMART Domains Protein: ENSMUSP00000028814
Gene: ENSMUSG00000027339

DomainStartEndE-ValueType
RA 174 265 5.33e-18 SMART
coiled coil region 292 312 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000103182
SMART Domains Protein: ENSMUSP00000099471
Gene: ENSMUSG00000027339

DomainStartEndE-ValueType
RA 174 265 5.33e-18 SMART
Pfam:Nore1-SARAH 277 316 3.9e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139047
SMART Domains Protein: ENSMUSP00000120194
Gene: ENSMUSG00000027339

DomainStartEndE-ValueType
Blast:RA 174 202 2e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155829
Meta Mutation Damage Score 0.9585 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a Ras association domain. Similar to its cattle and sheep counterparts, this gene is located near the prion gene. Two alternatively spliced transcripts encoding the same isoform have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit bone defects and hematopoeitic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bglap3 G C 3: 88,369,512 probably benign Het
Cdh3 A G 8: 106,511,308 T45A probably benign Het
Cdyl2 A G 8: 116,623,798 V198A probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp7a1 A T 4: 6,268,396 I443K probably benign Het
Dazap1 T A 10: 80,284,233 M234K possibly damaging Het
Dnmt1 A T 9: 20,924,146 probably benign Het
Dusp8 A G 7: 142,090,063 Y38H probably damaging Het
Ewsr1 A G 11: 5,091,857 probably null Het
Fem1b T C 9: 62,797,003 H325R probably damaging Het
Flrt3 C A 2: 140,661,391 V106F possibly damaging Het
Foxp2 T A 6: 15,409,939 S513T possibly damaging Het
Gm5600 G T 7: 113,707,804 noncoding transcript Het
Haspin A G 11: 73,136,085 I726T probably benign Het
Lama4 T A 10: 39,042,567 probably null Het
Lrrc7 A T 3: 158,170,661 H597Q probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Plcb4 C T 2: 135,939,973 T238M probably damaging Het
Plekhd1 A G 12: 80,722,099 probably null Het
Prph C G 15: 99,055,282 probably benign Het
Saal1 A G 7: 46,692,811 F403L probably benign Het
Serpina3a C T 12: 104,116,499 T177I probably benign Het
Slc23a2 C T 2: 132,094,195 E52K possibly damaging Het
Stab2 T A 10: 86,954,474 probably null Het
Syne3 T A 12: 104,969,234 E95V probably damaging Het
Vmn1r58 G T 7: 5,410,940 T97N probably damaging Het
Vmn2r61 T G 7: 42,266,863 L300W probably damaging Het
Vps13a T C 19: 16,743,057 E388G possibly damaging Het
Other mutations in Rassf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01991:Rassf2 APN 2 132000432 critical splice donor site probably null
IGL02142:Rassf2 APN 2 131996433 missense possibly damaging 0.69
IGL02694:Rassf2 APN 2 132009721 missense possibly damaging 0.91
IGL02727:Rassf2 APN 2 132004387 missense probably benign 0.11
R0722:Rassf2 UTSW 2 132002910 missense probably damaging 1.00
R2508:Rassf2 UTSW 2 131998243 critical splice donor site probably null
R3808:Rassf2 UTSW 2 131998260 splice site probably null
R3809:Rassf2 UTSW 2 131998260 splice site probably null
R4077:Rassf2 UTSW 2 132012602 missense probably benign
R4085:Rassf2 UTSW 2 132004379 missense probably damaging 1.00
R4285:Rassf2 UTSW 2 132005394 missense probably benign 0.17
R4721:Rassf2 UTSW 2 132004438 missense probably benign
R4762:Rassf2 UTSW 2 132002863 unclassified probably benign
R5012:Rassf2 UTSW 2 132009690 missense probably damaging 1.00
R6545:Rassf2 UTSW 2 131998317 missense probably damaging 0.98
R6788:Rassf2 UTSW 2 132002925 missense probably damaging 1.00
R7232:Rassf2 UTSW 2 131996412 missense probably damaging 1.00
R7711:Rassf2 UTSW 2 132005377 missense probably benign 0.04
X0063:Rassf2 UTSW 2 131998254 missense probably damaging 1.00
Z1177:Rassf2 UTSW 2 132004369 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCATCCGAAGTCCTCAGAG -3'
(R):5'- CCTGGGGAGAAAGGTTTATGGC -3'

Sequencing Primer
(F):5'- CCGGAGGCTCAAGAAAGTTATTC -3'
(R):5'- AAAGGTTTATGGCTGAGCTCAG -3'
Posted On2014-10-30