Incidental Mutation 'R2326:Flrt3'
ID244907
Institutional Source Beutler Lab
Gene Symbol Flrt3
Ensembl Gene ENSMUSG00000051379
Gene Namefibronectin leucine rich transmembrane protein 3
Synonyms5530600M07Rik, C430047I10Rik
MMRRC Submission 040317-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2326 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location140650914-140671469 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 140661391 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 106 (V106F)
Ref Sequence ENSEMBL: ENSMUSP00000105684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056760] [ENSMUST00000078027] [ENSMUST00000110057] [ENSMUST00000110063] [ENSMUST00000110064] [ENSMUST00000110067]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056760
AA Change: V106F

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000053399
Gene: ENSMUSG00000051379
AA Change: V106F

DomainStartEndE-ValueType
LRRNT 30 62 3.12e-6 SMART
LRR 82 105 1.03e2 SMART
LRR 127 152 8.26e1 SMART
LRR 156 176 4.58e1 SMART
LRR 198 223 4.09e1 SMART
LRR 224 247 1.33e1 SMART
LRR 248 269 4.2e0 SMART
LRR_TYP 270 293 7.9e-4 SMART
LRRCT 305 356 1.49e-9 SMART
FN3 404 486 4.56e0 SMART
transmembrane domain 530 552 N/A INTRINSIC
low complexity region 625 639 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078027
SMART Domains Protein: ENSMUSP00000077174
Gene: ENSMUSG00000068205

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
A1pp 71 201 5.72e-45 SMART
low complexity region 266 293 N/A INTRINSIC
low complexity region 307 319 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110057
AA Change: V106F

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105684
Gene: ENSMUSG00000051379
AA Change: V106F

DomainStartEndE-ValueType
LRRNT 30 62 3.12e-6 SMART
LRR 82 105 1.03e2 SMART
LRR 127 152 8.26e1 SMART
LRR 156 176 4.58e1 SMART
LRR 198 223 4.09e1 SMART
LRR 224 247 1.33e1 SMART
LRR 248 269 4.2e0 SMART
LRR_TYP 270 293 7.9e-4 SMART
LRRCT 305 356 1.49e-9 SMART
FN3 404 486 4.56e0 SMART
transmembrane domain 530 552 N/A INTRINSIC
low complexity region 625 639 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110063
SMART Domains Protein: ENSMUSP00000105690
Gene: ENSMUSG00000068205

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
PDB:4IQY|B 21 107 1e-36 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000110064
SMART Domains Protein: ENSMUSP00000105691
Gene: ENSMUSG00000068205

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
A1pp 71 201 5.72e-45 SMART
low complexity region 266 293 N/A INTRINSIC
low complexity region 307 319 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110067
SMART Domains Protein: ENSMUSP00000105694
Gene: ENSMUSG00000068205

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
A1pp 71 201 5.72e-45 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138485
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172544
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fibronectin leucine rich transmembrane protein (FLRT) family. FLRTs may function in cell adhesion and/or receptor signalling. Their protein structures resemble small leucine-rich proteoglycans found in the extracellular matrix. This gene is expressed in many tissues. Two alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis, abnormal embryonic tissue development, disrupted head formation, cardia bifida and abnormal ventral wall closure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bglap3 G C 3: 88,369,512 probably benign Het
Cdh3 A G 8: 106,511,308 T45A probably benign Het
Cdyl2 A G 8: 116,623,798 V198A probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp7a1 A T 4: 6,268,396 I443K probably benign Het
Dazap1 T A 10: 80,284,233 M234K possibly damaging Het
Dnmt1 A T 9: 20,924,146 probably benign Het
Dusp8 A G 7: 142,090,063 Y38H probably damaging Het
Ewsr1 A G 11: 5,091,857 probably null Het
Fem1b T C 9: 62,797,003 H325R probably damaging Het
Foxp2 T A 6: 15,409,939 S513T possibly damaging Het
Gm5600 G T 7: 113,707,804 noncoding transcript Het
Haspin A G 11: 73,136,085 I726T probably benign Het
Lama4 T A 10: 39,042,567 probably null Het
Lrrc7 A T 3: 158,170,661 H597Q probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Plcb4 C T 2: 135,939,973 T238M probably damaging Het
Plekhd1 A G 12: 80,722,099 probably null Het
Prph C G 15: 99,055,282 probably benign Het
Rassf2 C T 2: 132,000,432 probably null Het
Saal1 A G 7: 46,692,811 F403L probably benign Het
Serpina3a C T 12: 104,116,499 T177I probably benign Het
Slc23a2 C T 2: 132,094,195 E52K possibly damaging Het
Stab2 T A 10: 86,954,474 probably null Het
Syne3 T A 12: 104,969,234 E95V probably damaging Het
Vmn1r58 G T 7: 5,410,940 T97N probably damaging Het
Vmn2r61 T G 7: 42,266,863 L300W probably damaging Het
Vps13a T C 19: 16,743,057 E388G possibly damaging Het
Other mutations in Flrt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02141:Flrt3 APN 2 140660688 missense probably damaging 0.99
IGL02292:Flrt3 APN 2 140660125 missense probably damaging 1.00
R0030:Flrt3 UTSW 2 140660317 missense probably damaging 1.00
R1487:Flrt3 UTSW 2 140660934 missense probably damaging 1.00
R2061:Flrt3 UTSW 2 140661453 missense probably damaging 1.00
R2115:Flrt3 UTSW 2 140661503 missense probably damaging 1.00
R3113:Flrt3 UTSW 2 140661534 missense probably benign 0.03
R3605:Flrt3 UTSW 2 140661367 missense probably damaging 1.00
R4366:Flrt3 UTSW 2 140660407 missense probably damaging 0.99
R4702:Flrt3 UTSW 2 140661655 missense probably benign
R4799:Flrt3 UTSW 2 140660166 missense probably damaging 1.00
R5085:Flrt3 UTSW 2 140660257 missense probably damaging 0.99
R5100:Flrt3 UTSW 2 140671384 start gained probably null
R5109:Flrt3 UTSW 2 140660743 missense possibly damaging 0.51
R5635:Flrt3 UTSW 2 140660500 missense probably damaging 1.00
R5982:Flrt3 UTSW 2 140660916 missense possibly damaging 0.95
R6117:Flrt3 UTSW 2 140660445 missense possibly damaging 0.46
R6213:Flrt3 UTSW 2 140661165 missense probably damaging 1.00
R6246:Flrt3 UTSW 2 140659801 missense probably damaging 1.00
R6746:Flrt3 UTSW 2 140660025 missense probably damaging 0.99
R6854:Flrt3 UTSW 2 140660718 missense probably damaging 1.00
R7000:Flrt3 UTSW 2 140660884 nonsense probably null
R7221:Flrt3 UTSW 2 140661170 missense probably damaging 0.99
R7388:Flrt3 UTSW 2 140661752 critical splice acceptor site probably null
R7444:Flrt3 UTSW 2 140660467 missense probably benign 0.00
R7526:Flrt3 UTSW 2 140660206 missense probably damaging 1.00
R7967:Flrt3 UTSW 2 140659891 nonsense probably null
R8272:Flrt3 UTSW 2 140660697 missense probably damaging 1.00
R8441:Flrt3 UTSW 2 140660626 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTCAATAGTCCTGGGCAAG -3'
(R):5'- AACGATCGCTCTCTGACATC -3'

Sequencing Primer
(F):5'- CCCGGGATTGTGCTAAGG -3'
(R):5'- CTGACATCCATTCCAGTGGG -3'
Posted On2014-10-30