Incidental Mutation 'R2326:Cyp7a1'
ID244911
Institutional Source Beutler Lab
Gene Symbol Cyp7a1
Ensembl Gene ENSMUSG00000028240
Gene Namecytochrome P450, family 7, subfamily a, polypeptide 1
Synonymscholesterol 7 alpha hydroxylase
MMRRC Submission 040317-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.339) question?
Stock #R2326 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location6265612-6275633 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 6268396 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 443 (I443K)
Ref Sequence ENSEMBL: ENSMUSP00000029905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029905]
Predicted Effect probably benign
Transcript: ENSMUST00000029905
AA Change: I443K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029905
Gene: ENSMUSG00000028240
AA Change: I443K

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:p450 32 497 2.3e-87 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147346
Meta Mutation Damage Score 0.1505 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum membrane protein catalyzes the first reaction in the cholesterol catabolic pathway in the liver, which converts cholesterol to bile acids. This reaction is the rate limiting step and the major site of regulation of bile acid synthesis, which is the primary mechanism for the removal of cholesterol from the body. Polymorphisms in the promoter of this gene are associated with defects in bile acid synthesis. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for disruption of this gene experience severe neonatal and postnatal lethality. Supplementation of the maternal diet with fat soluble vitamins and cholic acid starting before birth alleviates much of the phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bglap3 G C 3: 88,369,512 probably benign Het
Cdh3 A G 8: 106,511,308 T45A probably benign Het
Cdyl2 A G 8: 116,623,798 V198A probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dazap1 T A 10: 80,284,233 M234K possibly damaging Het
Dnmt1 A T 9: 20,924,146 probably benign Het
Dusp8 A G 7: 142,090,063 Y38H probably damaging Het
Ewsr1 A G 11: 5,091,857 probably null Het
Fem1b T C 9: 62,797,003 H325R probably damaging Het
Flrt3 C A 2: 140,661,391 V106F possibly damaging Het
Foxp2 T A 6: 15,409,939 S513T possibly damaging Het
Gm5600 G T 7: 113,707,804 noncoding transcript Het
Haspin A G 11: 73,136,085 I726T probably benign Het
Lama4 T A 10: 39,042,567 probably null Het
Lrrc7 A T 3: 158,170,661 H597Q probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Plcb4 C T 2: 135,939,973 T238M probably damaging Het
Plekhd1 A G 12: 80,722,099 probably null Het
Prph C G 15: 99,055,282 probably benign Het
Rassf2 C T 2: 132,000,432 probably null Het
Saal1 A G 7: 46,692,811 F403L probably benign Het
Serpina3a C T 12: 104,116,499 T177I probably benign Het
Slc23a2 C T 2: 132,094,195 E52K possibly damaging Het
Stab2 T A 10: 86,954,474 probably null Het
Syne3 T A 12: 104,969,234 E95V probably damaging Het
Vmn1r58 G T 7: 5,410,940 T97N probably damaging Het
Vmn2r61 T G 7: 42,266,863 L300W probably damaging Het
Vps13a T C 19: 16,743,057 E388G possibly damaging Het
Other mutations in Cyp7a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01298:Cyp7a1 APN 4 6275517 missense probably damaging 1.00
IGL01577:Cyp7a1 APN 4 6273618 missense probably damaging 1.00
IGL01723:Cyp7a1 APN 4 6272442 missense probably damaging 1.00
IGL02602:Cyp7a1 APN 4 6272871 missense possibly damaging 0.88
IGL03302:Cyp7a1 APN 4 6273801 missense probably benign 0.05
R1017:Cyp7a1 UTSW 4 6272307 missense probably damaging 1.00
R1737:Cyp7a1 UTSW 4 6272848 missense probably benign 0.00
R2044:Cyp7a1 UTSW 4 6275492 missense probably null 1.00
R2867:Cyp7a1 UTSW 4 6272493 missense probably damaging 0.99
R2867:Cyp7a1 UTSW 4 6272493 missense probably damaging 0.99
R3438:Cyp7a1 UTSW 4 6272769 missense probably damaging 1.00
R4181:Cyp7a1 UTSW 4 6271205 missense probably benign 0.09
R4844:Cyp7a1 UTSW 4 6273655 missense probably damaging 1.00
R5184:Cyp7a1 UTSW 4 6271207 missense probably benign
R5371:Cyp7a1 UTSW 4 6268378 missense probably damaging 1.00
R5613:Cyp7a1 UTSW 4 6272799 missense probably damaging 1.00
R5682:Cyp7a1 UTSW 4 6268429 missense probably benign 0.28
R5987:Cyp7a1 UTSW 4 6268476 missense probably benign 0.05
R5995:Cyp7a1 UTSW 4 6272371 missense possibly damaging 0.74
R6128:Cyp7a1 UTSW 4 6272788 missense possibly damaging 0.80
R6552:Cyp7a1 UTSW 4 6272361 nonsense probably null
R6860:Cyp7a1 UTSW 4 6272587 missense probably damaging 1.00
R7032:Cyp7a1 UTSW 4 6268463 missense possibly damaging 0.94
R7631:Cyp7a1 UTSW 4 6272763 missense possibly damaging 0.89
R7884:Cyp7a1 UTSW 4 6272697 missense probably benign 0.04
R8289:Cyp7a1 UTSW 4 6268295 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCTCAGCAGTCGTTACATC -3'
(R):5'- GGCACGAGTACTAGAAACTTACC -3'

Sequencing Primer
(F):5'- AGCAGTCGTTACATCATCCAGTG -3'
(R):5'- CGAGTACTAGAAACTTACCTTTTGGG -3'
Posted On2014-10-30