Incidental Mutation 'R2326:Vmn1r58'
ID244913
Institutional Source Beutler Lab
Gene Symbol Vmn1r58
Ensembl Gene ENSMUSG00000078808
Gene Namevomeronasal 1 receptor 58
SynonymsV3R4, V1rd4
MMRRC Submission 040317-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R2326 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location5401681-5413396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 5410940 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 97 (T97N)
Ref Sequence ENSEMBL: ENSMUSP00000154393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108569] [ENSMUST00000228728]
Predicted Effect probably damaging
Transcript: ENSMUST00000108569
AA Change: T97N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104209
Gene: ENSMUSG00000078808
AA Change: T97N

DomainStartEndE-ValueType
Pfam:TAS2R 1 296 7.8e-13 PFAM
Pfam:7tm_1 20 279 4.4e-7 PFAM
Pfam:V1R 31 296 7.7e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226315
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227549
Predicted Effect probably damaging
Transcript: ENSMUST00000228728
AA Change: T97N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bglap3 G C 3: 88,369,512 probably benign Het
Cdh3 A G 8: 106,511,308 T45A probably benign Het
Cdyl2 A G 8: 116,623,798 V198A probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp7a1 A T 4: 6,268,396 I443K probably benign Het
Dazap1 T A 10: 80,284,233 M234K possibly damaging Het
Dnmt1 A T 9: 20,924,146 probably benign Het
Dusp8 A G 7: 142,090,063 Y38H probably damaging Het
Ewsr1 A G 11: 5,091,857 probably null Het
Fem1b T C 9: 62,797,003 H325R probably damaging Het
Flrt3 C A 2: 140,661,391 V106F possibly damaging Het
Foxp2 T A 6: 15,409,939 S513T possibly damaging Het
Gm5600 G T 7: 113,707,804 noncoding transcript Het
Haspin A G 11: 73,136,085 I726T probably benign Het
Lama4 T A 10: 39,042,567 probably null Het
Lrrc7 A T 3: 158,170,661 H597Q probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Plcb4 C T 2: 135,939,973 T238M probably damaging Het
Plekhd1 A G 12: 80,722,099 probably null Het
Prph C G 15: 99,055,282 probably benign Het
Rassf2 C T 2: 132,000,432 probably null Het
Saal1 A G 7: 46,692,811 F403L probably benign Het
Serpina3a C T 12: 104,116,499 T177I probably benign Het
Slc23a2 C T 2: 132,094,195 E52K possibly damaging Het
Stab2 T A 10: 86,954,474 probably null Het
Syne3 T A 12: 104,969,234 E95V probably damaging Het
Vmn2r61 T G 7: 42,266,863 L300W probably damaging Het
Vps13a T C 19: 16,743,057 E388G possibly damaging Het
Other mutations in Vmn1r58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Vmn1r58 APN 7 5411055 missense probably benign 0.19
IGL02792:Vmn1r58 APN 7 5411229 start codon destroyed probably null 0.04
IGL03215:Vmn1r58 APN 7 5410836 missense probably benign 0.00
IGL03259:Vmn1r58 APN 7 5411087 nonsense probably null
K7894:Vmn1r58 UTSW 7 5410703 missense probably benign 0.01
R0033:Vmn1r58 UTSW 7 5410388 missense probably damaging 1.00
R0225:Vmn1r58 UTSW 7 5410866 missense probably benign 0.02
R0304:Vmn1r58 UTSW 7 5410496 missense probably damaging 1.00
R0360:Vmn1r58 UTSW 7 5410330 missense probably benign 0.25
R0363:Vmn1r58 UTSW 7 5410637 missense probably damaging 1.00
R0454:Vmn1r58 UTSW 7 5410998 missense possibly damaging 0.69
R0565:Vmn1r58 UTSW 7 5411166 missense probably benign 0.06
R0612:Vmn1r58 UTSW 7 5410619 missense probably damaging 1.00
R0646:Vmn1r58 UTSW 7 5410677 missense probably benign 0.00
R0853:Vmn1r58 UTSW 7 5410325 missense probably damaging 1.00
R0920:Vmn1r58 UTSW 7 5410789 missense probably benign 0.00
R1696:Vmn1r58 UTSW 7 5410728 missense possibly damaging 0.67
R1823:Vmn1r58 UTSW 7 5410406 missense possibly damaging 0.95
R4088:Vmn1r58 UTSW 7 5410655 missense probably damaging 1.00
R5065:Vmn1r58 UTSW 7 5410835 missense probably benign 0.00
R5087:Vmn1r58 UTSW 7 5410667 missense probably benign 0.04
R5407:Vmn1r58 UTSW 7 5410873 missense probably benign 0.01
R6855:Vmn1r58 UTSW 7 5410452 missense possibly damaging 0.56
R7052:Vmn1r58 UTSW 7 5411135 missense probably benign 0.04
R7334:Vmn1r58 UTSW 7 5411067 missense probably benign 0.04
R7763:Vmn1r58 UTSW 7 5410913 missense probably damaging 1.00
R7840:Vmn1r58 UTSW 7 5411243 start gained probably benign
R7875:Vmn1r58 UTSW 7 5410754 missense probably damaging 0.98
R8004:Vmn1r58 UTSW 7 5410507 nonsense probably null
R8115:Vmn1r58 UTSW 7 5410342 missense probably benign 0.00
R8781:Vmn1r58 UTSW 7 5410483 missense probably benign 0.00
R8802:Vmn1r58 UTSW 7 5411081 missense probably damaging 1.00
X0058:Vmn1r58 UTSW 7 5410395 missense possibly damaging 0.89
Z1176:Vmn1r58 UTSW 7 5410904 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTGTGGACCACTGACATTC -3'
(R):5'- GTGGGCAACATCCTTCTGTTTG -3'

Sequencing Primer
(F):5'- CCACTGACATTCATTGGGATGTAAGC -3'
(R):5'- TCTTGACTGACTCCAGACTGAAG -3'
Posted On2014-10-30