Incidental Mutation 'R2326:Gm5600'
ID244916
Institutional Source Beutler Lab
Gene Symbol Gm5600
Ensembl Gene ENSMUSG00000073862
Gene Namepredicted gene 5600
SynonymsENSMUSG00000073862
MMRRC Submission 040317-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R2326 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location113707715-113708200 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) G to T at 113707804 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098100
SMART Domains Protein: ENSMUSP00000095704
Gene: ENSMUSG00000073862

DomainStartEndE-ValueType
low complexity region 78 91 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211589
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bglap3 G C 3: 88,369,512 probably benign Het
Cdh3 A G 8: 106,511,308 T45A probably benign Het
Cdyl2 A G 8: 116,623,798 V198A probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp7a1 A T 4: 6,268,396 I443K probably benign Het
Dazap1 T A 10: 80,284,233 M234K possibly damaging Het
Dnmt1 A T 9: 20,924,146 probably benign Het
Dusp8 A G 7: 142,090,063 Y38H probably damaging Het
Ewsr1 A G 11: 5,091,857 probably null Het
Fem1b T C 9: 62,797,003 H325R probably damaging Het
Flrt3 C A 2: 140,661,391 V106F possibly damaging Het
Foxp2 T A 6: 15,409,939 S513T possibly damaging Het
Haspin A G 11: 73,136,085 I726T probably benign Het
Lama4 T A 10: 39,042,567 probably null Het
Lrrc7 A T 3: 158,170,661 H597Q probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Plcb4 C T 2: 135,939,973 T238M probably damaging Het
Plekhd1 A G 12: 80,722,099 probably null Het
Prph C G 15: 99,055,282 probably benign Het
Rassf2 C T 2: 132,000,432 probably null Het
Saal1 A G 7: 46,692,811 F403L probably benign Het
Serpina3a C T 12: 104,116,499 T177I probably benign Het
Slc23a2 C T 2: 132,094,195 E52K possibly damaging Het
Stab2 T A 10: 86,954,474 probably null Het
Syne3 T A 12: 104,969,234 E95V probably damaging Het
Vmn1r58 G T 7: 5,410,940 T97N probably damaging Het
Vmn2r61 T G 7: 42,266,863 L300W probably damaging Het
Vps13a T C 19: 16,743,057 E388G possibly damaging Het
Other mutations in Gm5600
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01896:Gm5600 APN 7 113707984 exon noncoding transcript
R0007:Gm5600 UTSW 7 113707773 exon noncoding transcript
R5613:Gm5600 UTSW 7 113708056 exon noncoding transcript
R5921:Gm5600 UTSW 7 113708176 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- AACCTATAGCTGCCTCCAGGAC -3'
(R):5'- TAAACTGTGGGCTGCTTTGC -3'

Sequencing Primer
(F):5'- TCCAGGACCAGTGCTTTAGAATC -3'
(R):5'- GAATGCTAGACCTCACCTGAGTCTG -3'
Posted On2014-10-30