Incidental Mutation 'R2326:Dusp8'
ID244917
Institutional Source Beutler Lab
Gene Symbol Dusp8
Ensembl Gene ENSMUSG00000037887
Gene Namedual specificity phosphatase 8
Synonyms5530400B01Rik, Nttp1
MMRRC Submission 040317-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R2326 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location142079490-142095843 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 142090063 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 38 (Y38H)
Ref Sequence ENSEMBL: ENSMUSP00000049414 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039926] [ENSMUST00000143661]
Predicted Effect probably damaging
Transcript: ENSMUST00000039926
AA Change: Y38H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049414
Gene: ENSMUSG00000037887
AA Change: Y38H

DomainStartEndE-ValueType
RHOD 13 135 4.71e-14 SMART
DSPc 160 299 3.6e-69 SMART
low complexity region 334 353 N/A INTRINSIC
low complexity region 360 371 N/A INTRINSIC
low complexity region 405 422 N/A INTRINSIC
low complexity region 427 449 N/A INTRINSIC
low complexity region 452 470 N/A INTRINSIC
low complexity region 488 512 N/A INTRINSIC
low complexity region 546 600 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000143661
AA Change: Y38H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114307
Gene: ENSMUSG00000037887
AA Change: Y38H

DomainStartEndE-ValueType
RHOD 13 135 4.71e-14 SMART
Pfam:DSPc 168 231 1.5e-9 PFAM
Meta Mutation Damage Score 0.8473 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which is associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates SAPK/JNK and p38, is expressed predominantly in the adult brain, heart, and skeletal muscle, is localized in the cytoplasm, and is induced by nerve growth factor and insulin. An intronless pseudogene for DUSP8 is present on chromosome 10q11.2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered myocardial fiber morphology, mildly increased cardiac muscle contractility at baseline, and decreased response of heart to induced stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bglap3 G C 3: 88,369,512 probably benign Het
Cdh3 A G 8: 106,511,308 T45A probably benign Het
Cdyl2 A G 8: 116,623,798 V198A probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp7a1 A T 4: 6,268,396 I443K probably benign Het
Dazap1 T A 10: 80,284,233 M234K possibly damaging Het
Dnmt1 A T 9: 20,924,146 probably benign Het
Ewsr1 A G 11: 5,091,857 probably null Het
Fem1b T C 9: 62,797,003 H325R probably damaging Het
Flrt3 C A 2: 140,661,391 V106F possibly damaging Het
Foxp2 T A 6: 15,409,939 S513T possibly damaging Het
Gm5600 G T 7: 113,707,804 noncoding transcript Het
Haspin A G 11: 73,136,085 I726T probably benign Het
Lama4 T A 10: 39,042,567 probably null Het
Lrrc7 A T 3: 158,170,661 H597Q probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Plcb4 C T 2: 135,939,973 T238M probably damaging Het
Plekhd1 A G 12: 80,722,099 probably null Het
Prph C G 15: 99,055,282 probably benign Het
Rassf2 C T 2: 132,000,432 probably null Het
Saal1 A G 7: 46,692,811 F403L probably benign Het
Serpina3a C T 12: 104,116,499 T177I probably benign Het
Slc23a2 C T 2: 132,094,195 E52K possibly damaging Het
Stab2 T A 10: 86,954,474 probably null Het
Syne3 T A 12: 104,969,234 E95V probably damaging Het
Vmn1r58 G T 7: 5,410,940 T97N probably damaging Het
Vmn2r61 T G 7: 42,266,863 L300W probably damaging Het
Vps13a T C 19: 16,743,057 E388G possibly damaging Het
Other mutations in Dusp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Dusp8 APN 7 142084423 missense probably benign 0.05
IGL02458:Dusp8 APN 7 142082747 missense probably benign 0.28
IGL02931:Dusp8 APN 7 142082930 missense probably benign 0.00
IGL03329:Dusp8 APN 7 142084360 nonsense probably null
R0009:Dusp8 UTSW 7 142082054 unclassified probably benign
R1054:Dusp8 UTSW 7 142082067 unclassified probably benign
R1611:Dusp8 UTSW 7 142082957 missense probably benign 0.04
R1883:Dusp8 UTSW 7 142084348 splice site probably null
R2119:Dusp8 UTSW 7 142082561 missense possibly damaging 0.91
R2698:Dusp8 UTSW 7 142081964 unclassified probably benign
R2905:Dusp8 UTSW 7 142083389 nonsense probably null
R3849:Dusp8 UTSW 7 142090065 missense probably damaging 1.00
R4921:Dusp8 UTSW 7 142082154 unclassified probably benign
R4942:Dusp8 UTSW 7 142082228 missense possibly damaging 0.85
R5288:Dusp8 UTSW 7 142089993 missense possibly damaging 0.95
R5385:Dusp8 UTSW 7 142089993 missense possibly damaging 0.95
R5386:Dusp8 UTSW 7 142089993 missense possibly damaging 0.95
R6301:Dusp8 UTSW 7 142083019 splice site probably null
R6520:Dusp8 UTSW 7 142083681 missense probably damaging 0.99
R6665:Dusp8 UTSW 7 142090105 missense probably damaging 0.97
RF016:Dusp8 UTSW 7 142082852 missense probably benign 0.04
X0064:Dusp8 UTSW 7 142082027 unclassified probably benign
Z1176:Dusp8 UTSW 7 142081943 missense unknown
Z1176:Dusp8 UTSW 7 142090077 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCTCAGGAATGGTCAGCC -3'
(R):5'- AGATCCCACCATCTGCTGAC -3'

Sequencing Primer
(F):5'- CTCAGGAATGGTCAGCCCTGAAG -3'
(R):5'- GGTCTGGCACCATGCACTAG -3'
Posted On2014-10-30