Incidental Mutation 'R2326:Cdyl2'
ID244919
Institutional Source Beutler Lab
Gene Symbol Cdyl2
Ensembl Gene ENSMUSG00000031758
Gene Namechromodomain protein, Y chromosome-like 2
Synonyms
MMRRC Submission 040317-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R2326 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location116574400-116732991 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116623798 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 198 (V198A)
Ref Sequence ENSEMBL: ENSMUSP00000104730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109102]
Predicted Effect probably benign
Transcript: ENSMUST00000109102
AA Change: V198A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104730
Gene: ENSMUSG00000031758
AA Change: V198A

DomainStartEndE-ValueType
CHROMO 6 60 1.25e-17 SMART
Pfam:ECH_1 252 499 5e-33 PFAM
Pfam:ECH_2 258 501 1.6e-14 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bglap3 G C 3: 88,369,512 probably benign Het
Cdh3 A G 8: 106,511,308 T45A probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp7a1 A T 4: 6,268,396 I443K probably benign Het
Dazap1 T A 10: 80,284,233 M234K possibly damaging Het
Dnmt1 A T 9: 20,924,146 probably benign Het
Dusp8 A G 7: 142,090,063 Y38H probably damaging Het
Ewsr1 A G 11: 5,091,857 probably null Het
Fem1b T C 9: 62,797,003 H325R probably damaging Het
Flrt3 C A 2: 140,661,391 V106F possibly damaging Het
Foxp2 T A 6: 15,409,939 S513T possibly damaging Het
Gm5600 G T 7: 113,707,804 noncoding transcript Het
Haspin A G 11: 73,136,085 I726T probably benign Het
Lama4 T A 10: 39,042,567 probably null Het
Lrrc7 A T 3: 158,170,661 H597Q probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Plcb4 C T 2: 135,939,973 T238M probably damaging Het
Plekhd1 A G 12: 80,722,099 probably null Het
Prph C G 15: 99,055,282 probably benign Het
Rassf2 C T 2: 132,000,432 probably null Het
Saal1 A G 7: 46,692,811 F403L probably benign Het
Serpina3a C T 12: 104,116,499 T177I probably benign Het
Slc23a2 C T 2: 132,094,195 E52K possibly damaging Het
Stab2 T A 10: 86,954,474 probably null Het
Syne3 T A 12: 104,969,234 E95V probably damaging Het
Vmn1r58 G T 7: 5,410,940 T97N probably damaging Het
Vmn2r61 T G 7: 42,266,863 L300W probably damaging Het
Vps13a T C 19: 16,743,057 E388G possibly damaging Het
Other mutations in Cdyl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Cdyl2 APN 8 116595189 splice site probably benign
IGL01670:Cdyl2 APN 8 116624353 missense probably damaging 1.00
IGL01964:Cdyl2 APN 8 116624029 missense probably benign 0.00
IGL02148:Cdyl2 APN 8 116589244 splice site probably benign
IGL02186:Cdyl2 APN 8 116579286 missense possibly damaging 0.78
Allein UTSW 8 116579196 missense probably damaging 1.00
R0449:Cdyl2 UTSW 8 116583192 missense probably damaging 1.00
R0630:Cdyl2 UTSW 8 116624035 missense probably benign 0.03
R1430:Cdyl2 UTSW 8 116579317 splice site probably benign
R1883:Cdyl2 UTSW 8 116595163 missense probably damaging 1.00
R4194:Cdyl2 UTSW 8 116579164 splice site probably null
R4916:Cdyl2 UTSW 8 116579187 missense probably damaging 1.00
R4977:Cdyl2 UTSW 8 116575269 missense probably damaging 0.99
R5092:Cdyl2 UTSW 8 116623940 missense possibly damaging 0.50
R5320:Cdyl2 UTSW 8 116595055 nonsense probably null
R5727:Cdyl2 UTSW 8 116583168 missense probably damaging 1.00
R5830:Cdyl2 UTSW 8 116595084 missense probably benign 0.23
R6077:Cdyl2 UTSW 8 116589390 missense probably damaging 1.00
R6086:Cdyl2 UTSW 8 116589296 missense probably damaging 1.00
R6145:Cdyl2 UTSW 8 116594978 missense probably damaging 1.00
R6380:Cdyl2 UTSW 8 116583184 missense probably damaging 1.00
R7152:Cdyl2 UTSW 8 116624327 missense probably damaging 1.00
R7193:Cdyl2 UTSW 8 116623994 missense probably benign 0.09
R7244:Cdyl2 UTSW 8 116575260 nonsense probably null
R7394:Cdyl2 UTSW 8 116624051 missense not run
R7457:Cdyl2 UTSW 8 116579196 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTAGGTTGAAAGAAAAGTCAGACC -3'
(R):5'- CAGATCATGCCCCTGAAGAAGG -3'

Sequencing Primer
(F):5'- TGAGTAGAGTCCTTACCCAGCATG -3'
(R):5'- ATGCCCCTGAAGAAGGCTCAG -3'
Posted On2014-10-30