Incidental Mutation 'R2326:Fem1b'
ID244921
Institutional Source Beutler Lab
Gene Symbol Fem1b
Ensembl Gene ENSMUSG00000032244
Gene Namefeminization 1 homolog b (C. elegans)
Synonyms
MMRRC Submission 040317-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.519) question?
Stock #R2326 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location62791821-62811934 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62797003 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 325 (H325R)
Ref Sequence ENSEMBL: ENSMUSP00000034775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034775]
Predicted Effect probably damaging
Transcript: ENSMUST00000034775
AA Change: H325R

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034775
Gene: ENSMUSG00000032244
AA Change: H325R

DomainStartEndE-ValueType
ANK 45 74 6.81e-3 SMART
ANK 87 116 6.65e-6 SMART
ANK 120 149 8.39e-3 SMART
ANK 153 182 8.91e-7 SMART
ANK 186 215 4.13e-2 SMART
ANK 218 246 6.71e-2 SMART
ANK 483 527 1.72e1 SMART
ANK 531 570 6.05e2 SMART
Meta Mutation Damage Score 0.1492 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an ankyrin repeat protein that belongs to the death receptor-associated family of proteins and plays a role in mediating apoptosis. The encoded protein is also thought to function in the replication stress-induced checkpoint signaling pathway via interaction with checkpoint kinase 1. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous targeted mutants display abnormal glucose tolerance due to defective glucose-stimulated insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bglap3 G C 3: 88,369,512 probably benign Het
Cdh3 A G 8: 106,511,308 T45A probably benign Het
Cdyl2 A G 8: 116,623,798 V198A probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp7a1 A T 4: 6,268,396 I443K probably benign Het
Dazap1 T A 10: 80,284,233 M234K possibly damaging Het
Dnmt1 A T 9: 20,924,146 probably benign Het
Dusp8 A G 7: 142,090,063 Y38H probably damaging Het
Ewsr1 A G 11: 5,091,857 probably null Het
Flrt3 C A 2: 140,661,391 V106F possibly damaging Het
Foxp2 T A 6: 15,409,939 S513T possibly damaging Het
Gm5600 G T 7: 113,707,804 noncoding transcript Het
Haspin A G 11: 73,136,085 I726T probably benign Het
Lama4 T A 10: 39,042,567 probably null Het
Lrrc7 A T 3: 158,170,661 H597Q probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Plcb4 C T 2: 135,939,973 T238M probably damaging Het
Plekhd1 A G 12: 80,722,099 probably null Het
Prph C G 15: 99,055,282 probably benign Het
Rassf2 C T 2: 132,000,432 probably null Het
Saal1 A G 7: 46,692,811 F403L probably benign Het
Serpina3a C T 12: 104,116,499 T177I probably benign Het
Slc23a2 C T 2: 132,094,195 E52K possibly damaging Het
Stab2 T A 10: 86,954,474 probably null Het
Syne3 T A 12: 104,969,234 E95V probably damaging Het
Vmn1r58 G T 7: 5,410,940 T97N probably damaging Het
Vmn2r61 T G 7: 42,266,863 L300W probably damaging Het
Vps13a T C 19: 16,743,057 E388G possibly damaging Het
Other mutations in Fem1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00811:Fem1b APN 9 62796919 missense probably damaging 1.00
IGL01306:Fem1b APN 9 62797528 missense possibly damaging 0.69
IGL02059:Fem1b APN 9 62796164 missense possibly damaging 0.57
IGL02292:Fem1b APN 9 62796695 missense probably benign 0.00
IGL03390:Fem1b APN 9 62796964 missense probably benign 0.01
ANU23:Fem1b UTSW 9 62797528 missense possibly damaging 0.69
R0054:Fem1b UTSW 9 62796800 missense probably damaging 1.00
R0054:Fem1b UTSW 9 62796800 missense probably damaging 1.00
R0733:Fem1b UTSW 9 62796843 missense possibly damaging 0.50
R1661:Fem1b UTSW 9 62797274 missense probably damaging 0.96
R1697:Fem1b UTSW 9 62797174 missense possibly damaging 0.56
R2228:Fem1b UTSW 9 62796738 nonsense probably null
R3123:Fem1b UTSW 9 62796554 missense probably benign 0.00
R3124:Fem1b UTSW 9 62796554 missense probably benign 0.00
R3125:Fem1b UTSW 9 62796554 missense probably benign 0.00
R4849:Fem1b UTSW 9 62797294 missense probably damaging 1.00
R5749:Fem1b UTSW 9 62797006 missense probably damaging 1.00
R6338:Fem1b UTSW 9 62797011 missense probably benign 0.08
R6727:Fem1b UTSW 9 62796733 missense possibly damaging 0.65
R7036:Fem1b UTSW 9 62797028 missense probably damaging 1.00
R7287:Fem1b UTSW 9 62796122 missense probably benign 0.00
R7538:Fem1b UTSW 9 62811167 missense probably damaging 0.98
R7877:Fem1b UTSW 9 62796562 missense probably benign 0.13
R8079:Fem1b UTSW 9 62796361 missense probably damaging 1.00
R8110:Fem1b UTSW 9 62796268 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGAGCAAACCGAAGCAGATC -3'
(R):5'- GCCTCCTTTGCAAATGATCG -3'

Sequencing Primer
(F):5'- CAAACCGAAGCAGATCTTTGTG -3'
(R):5'- TCGTGAGAACTATGACATCATGAAG -3'
Posted On2014-10-30