Incidental Mutation 'R2326:Ewsr1'
ID244926
Institutional Source Beutler Lab
Gene Symbol Ewsr1
Ensembl Gene ENSMUSG00000009079
Gene NameEwing sarcoma breakpoint region 1
SynonymsEws
MMRRC Submission 040317-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2326 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location5069689-5099266 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 5091857 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063232] [ENSMUST00000073308] [ENSMUST00000079949] [ENSMUST00000093365] [ENSMUST00000102930]
Predicted Effect probably null
Transcript: ENSMUST00000063232
SMART Domains Protein: ENSMUSP00000066827
Gene: ENSMUSG00000009079

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
low complexity region 51 71 N/A INTRINSIC
low complexity region 78 97 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000073308
SMART Domains Protein: ENSMUSP00000073034
Gene: ENSMUSG00000009079

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
internal_repeat_1 26 41 5.91e-6 PROSPERO
low complexity region 51 71 N/A INTRINSIC
low complexity region 91 121 N/A INTRINSIC
internal_repeat_1 155 170 5.91e-6 PROSPERO
low complexity region 187 211 N/A INTRINSIC
low complexity region 213 266 N/A INTRINSIC
low complexity region 296 315 N/A INTRINSIC
RRM 324 405 8.38e-17 SMART
low complexity region 416 475 N/A INTRINSIC
ZnF_RBZ 482 508 6.22e-7 SMART
low complexity region 512 586 N/A INTRINSIC
low complexity region 592 602 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000079949
SMART Domains Protein: ENSMUSP00000078867
Gene: ENSMUSG00000009079

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
internal_repeat_1 26 41 2.98e-6 PROSPERO
low complexity region 51 71 N/A INTRINSIC
low complexity region 91 121 N/A INTRINSIC
internal_repeat_1 155 170 2.98e-6 PROSPERO
low complexity region 187 211 N/A INTRINSIC
low complexity region 213 266 N/A INTRINSIC
low complexity region 300 331 N/A INTRINSIC
low complexity region 335 356 N/A INTRINSIC
RRM 361 442 8.38e-17 SMART
low complexity region 453 512 N/A INTRINSIC
ZnF_RBZ 519 545 6.22e-7 SMART
low complexity region 549 623 N/A INTRINSIC
low complexity region 629 639 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000093365
SMART Domains Protein: ENSMUSP00000091057
Gene: ENSMUSG00000009079

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
internal_repeat_1 26 41 2.29e-5 PROSPERO
low complexity region 51 71 N/A INTRINSIC
low complexity region 91 121 N/A INTRINSIC
internal_repeat_1 155 170 2.29e-5 PROSPERO
low complexity region 187 211 N/A INTRINSIC
low complexity region 213 266 N/A INTRINSIC
low complexity region 300 325 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102930
SMART Domains Protein: ENSMUSP00000099994
Gene: ENSMUSG00000009079

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
internal_repeat_1 26 41 3.23e-6 PROSPERO
low complexity region 51 71 N/A INTRINSIC
low complexity region 97 127 N/A INTRINSIC
internal_repeat_1 161 176 3.23e-6 PROSPERO
low complexity region 193 217 N/A INTRINSIC
low complexity region 219 272 N/A INTRINSIC
low complexity region 306 337 N/A INTRINSIC
low complexity region 341 362 N/A INTRINSIC
RRM 367 448 8.38e-17 SMART
low complexity region 459 518 N/A INTRINSIC
ZnF_RBZ 525 551 6.22e-7 SMART
low complexity region 555 629 N/A INTRINSIC
low complexity region 635 645 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151847
Meta Mutation Damage Score 0.9502 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (31/31)
MGI Phenotype PHENOTYPE: Homozygous mutant mice exhibit postnatal lethality, defective pre-B cell development, apoptosis of gametes and arrest in gamete maturation due to reduced meiotic recombination leading to infertility, kyphosis, lymphopenia, muscular atrophy, and hypersensitivity to ionizing radiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bglap3 G C 3: 88,369,512 probably benign Het
Cdh3 A G 8: 106,511,308 T45A probably benign Het
Cdyl2 A G 8: 116,623,798 V198A probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp7a1 A T 4: 6,268,396 I443K probably benign Het
Dazap1 T A 10: 80,284,233 M234K possibly damaging Het
Dnmt1 A T 9: 20,924,146 probably benign Het
Dusp8 A G 7: 142,090,063 Y38H probably damaging Het
Fem1b T C 9: 62,797,003 H325R probably damaging Het
Flrt3 C A 2: 140,661,391 V106F possibly damaging Het
Foxp2 T A 6: 15,409,939 S513T possibly damaging Het
Gm5600 G T 7: 113,707,804 noncoding transcript Het
Haspin A G 11: 73,136,085 I726T probably benign Het
Lama4 T A 10: 39,042,567 probably null Het
Lrrc7 A T 3: 158,170,661 H597Q probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Plcb4 C T 2: 135,939,973 T238M probably damaging Het
Plekhd1 A G 12: 80,722,099 probably null Het
Prph C G 15: 99,055,282 probably benign Het
Rassf2 C T 2: 132,000,432 probably null Het
Saal1 A G 7: 46,692,811 F403L probably benign Het
Serpina3a C T 12: 104,116,499 T177I probably benign Het
Slc23a2 C T 2: 132,094,195 E52K possibly damaging Het
Stab2 T A 10: 86,954,474 probably null Het
Syne3 T A 12: 104,969,234 E95V probably damaging Het
Vmn1r58 G T 7: 5,410,940 T97N probably damaging Het
Vmn2r61 T G 7: 42,266,863 L300W probably damaging Het
Vps13a T C 19: 16,743,057 E388G possibly damaging Het
Other mutations in Ewsr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02000:Ewsr1 APN 11 5088077 missense probably damaging 1.00
IGL02218:Ewsr1 APN 11 5070668 missense unknown
IGL02288:Ewsr1 APN 11 5093689 missense possibly damaging 0.53
IGL02410:Ewsr1 APN 11 5093863 splice site probably benign
R0485:Ewsr1 UTSW 11 5070737 splice site probably benign
R0570:Ewsr1 UTSW 11 5085935 missense possibly damaging 0.80
R1546:Ewsr1 UTSW 11 5078574 unclassified probably benign
R1688:Ewsr1 UTSW 11 5072870 missense unknown
R2074:Ewsr1 UTSW 11 5071555 missense unknown
R2158:Ewsr1 UTSW 11 5091450 splice site probably benign
R2880:Ewsr1 UTSW 11 5078523 unclassified probably benign
R2881:Ewsr1 UTSW 11 5078523 unclassified probably benign
R2882:Ewsr1 UTSW 11 5078523 unclassified probably benign
R3965:Ewsr1 UTSW 11 5083476 missense unknown
R4743:Ewsr1 UTSW 11 5083541 missense unknown
R4782:Ewsr1 UTSW 11 5070423 missense unknown
R5023:Ewsr1 UTSW 11 5088054 missense possibly damaging 0.83
R5194:Ewsr1 UTSW 11 5082355 missense unknown
R5422:Ewsr1 UTSW 11 5080668 intron probably benign
R5790:Ewsr1 UTSW 11 5082263 intron probably benign
R6993:Ewsr1 UTSW 11 5071573 missense probably benign 0.23
R7719:Ewsr1 UTSW 11 5085900 missense unknown
Predicted Primers PCR Primer
(F):5'- AGAAGGCTCATTCTTATCCCTAAG -3'
(R):5'- GGCTAAGCTACAAGGTTCTCTTATG -3'

Sequencing Primer
(F):5'- CTACCCACCTTCTATTGGATAGCAC -3'
(R):5'- ATACTCAGGCTCAGACCA -3'
Posted On2014-10-30