Incidental Mutation 'R2326:Haspin'
ID244927
Institutional Source Beutler Lab
Gene Symbol Haspin
Ensembl Gene ENSMUSG00000050107
Gene Namehistone H3 associated protein kinase
SynonymsGsg2
MMRRC Submission 040317-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.767) question?
Stock #R2326 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location73135485-73138294 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73136085 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 726 (I726T)
Ref Sequence ENSEMBL: ENSMUSP00000055806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006101] [ENSMUST00000052140] [ENSMUST00000102537]
Predicted Effect probably benign
Transcript: ENSMUST00000006101
SMART Domains Protein: ENSMUSP00000006101
Gene: ENSMUSG00000005947

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:Int_alpha 36 118 1e-24 BLAST
VWA 193 380 1.13e-39 SMART
Int_alpha 448 496 1.49e-3 SMART
Int_alpha 502 559 6.83e-12 SMART
Int_alpha 565 626 1.79e-15 SMART
Int_alpha 633 685 6.29e0 SMART
transmembrane domain 1115 1137 N/A INTRINSIC
Pfam:Integrin_alpha 1138 1152 1.1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052140
AA Change: I726T

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000055806
Gene: ENSMUSG00000050107
AA Change: I726T

DomainStartEndE-ValueType
low complexity region 61 67 N/A INTRINSIC
low complexity region 74 89 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
low complexity region 357 378 N/A INTRINSIC
SCOP:d1h8fa_ 437 619 1e-8 SMART
DUF3635 664 753 3.83e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102537
SMART Domains Protein: ENSMUSP00000099596
Gene: ENSMUSG00000005947

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:Int_alpha 36 118 5e-25 BLAST
VWA 193 380 1.13e-39 SMART
Int_alpha 448 496 1.49e-3 SMART
Int_alpha 502 559 6.83e-12 SMART
Int_alpha 565 626 1.79e-15 SMART
Int_alpha 633 685 6.29e0 SMART
Meta Mutation Damage Score 0.3186 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bglap3 G C 3: 88,369,512 probably benign Het
Cdh3 A G 8: 106,511,308 T45A probably benign Het
Cdyl2 A G 8: 116,623,798 V198A probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp7a1 A T 4: 6,268,396 I443K probably benign Het
Dazap1 T A 10: 80,284,233 M234K possibly damaging Het
Dnmt1 A T 9: 20,924,146 probably benign Het
Dusp8 A G 7: 142,090,063 Y38H probably damaging Het
Ewsr1 A G 11: 5,091,857 probably null Het
Fem1b T C 9: 62,797,003 H325R probably damaging Het
Flrt3 C A 2: 140,661,391 V106F possibly damaging Het
Foxp2 T A 6: 15,409,939 S513T possibly damaging Het
Gm5600 G T 7: 113,707,804 noncoding transcript Het
Lama4 T A 10: 39,042,567 probably null Het
Lrrc7 A T 3: 158,170,661 H597Q probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Plcb4 C T 2: 135,939,973 T238M probably damaging Het
Plekhd1 A G 12: 80,722,099 probably null Het
Prph C G 15: 99,055,282 probably benign Het
Rassf2 C T 2: 132,000,432 probably null Het
Saal1 A G 7: 46,692,811 F403L probably benign Het
Serpina3a C T 12: 104,116,499 T177I probably benign Het
Slc23a2 C T 2: 132,094,195 E52K possibly damaging Het
Stab2 T A 10: 86,954,474 probably null Het
Syne3 T A 12: 104,969,234 E95V probably damaging Het
Vmn1r58 G T 7: 5,410,940 T97N probably damaging Het
Vmn2r61 T G 7: 42,266,863 L300W probably damaging Het
Vps13a T C 19: 16,743,057 E388G possibly damaging Het
Other mutations in Haspin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Haspin APN 11 73137405 missense possibly damaging 0.85
IGL03088:Haspin APN 11 73136625 missense probably damaging 1.00
IGL03103:Haspin APN 11 73136700 missense probably damaging 1.00
Suddenly UTSW 11 73136886 missense probably benign 0.02
yesterday UTSW 11 73137551 nonsense probably null
R0034:Haspin UTSW 11 73138218 missense probably damaging 1.00
R0276:Haspin UTSW 11 73136487 missense probably damaging 1.00
R0313:Haspin UTSW 11 73136298 missense probably damaging 0.97
R2165:Haspin UTSW 11 73136630 missense probably damaging 1.00
R3950:Haspin UTSW 11 73136395 missense probably damaging 1.00
R4168:Haspin UTSW 11 73136022 missense probably damaging 1.00
R4565:Haspin UTSW 11 73137619 missense probably benign 0.00
R6532:Haspin UTSW 11 73137551 nonsense probably null
R6552:Haspin UTSW 11 73137564 missense probably benign 0.02
R6952:Haspin UTSW 11 73136145 missense possibly damaging 0.95
R7237:Haspin UTSW 11 73136886 missense probably benign 0.02
R7512:Haspin UTSW 11 73136592 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGACAGGAACTCTTAAGGATG -3'
(R):5'- TCCGCTGAAGAGGACCTATTTAC -3'

Sequencing Primer
(F):5'- GGAACTCTTAAGGATGTGCTTTCACC -3'
(R):5'- CCTATTTACAGGTGAGGGTGACTACC -3'
Posted On2014-10-30