Incidental Mutation 'R2326:Plekhd1'
ID244929
Institutional Source Beutler Lab
Gene Symbol Plekhd1
Ensembl Gene ENSMUSG00000066438
Gene Namepleckstrin homology domain containing, family D (with coiled-coil domains) member 1
Synonyms
MMRRC Submission 040317-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R2326 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location80692591-80724214 bp(+) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) A to G at 80722099 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119711 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000140770] [ENSMUST00000140770]
Predicted Effect probably null
Transcript: ENSMUST00000140770
SMART Domains Protein: ENSMUSP00000119711
Gene: ENSMUSG00000066438

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
PH 29 138 9.19e-13 SMART
coiled coil region 146 392 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000140770
SMART Domains Protein: ENSMUSP00000119711
Gene: ENSMUSG00000066438

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
PH 29 138 9.19e-13 SMART
coiled coil region 146 392 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142760
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152465
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153762
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bglap3 G C 3: 88,369,512 probably benign Het
Cdh3 A G 8: 106,511,308 T45A probably benign Het
Cdyl2 A G 8: 116,623,798 V198A probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp7a1 A T 4: 6,268,396 I443K probably benign Het
Dazap1 T A 10: 80,284,233 M234K possibly damaging Het
Dnmt1 A T 9: 20,924,146 probably benign Het
Dusp8 A G 7: 142,090,063 Y38H probably damaging Het
Ewsr1 A G 11: 5,091,857 probably null Het
Fem1b T C 9: 62,797,003 H325R probably damaging Het
Flrt3 C A 2: 140,661,391 V106F possibly damaging Het
Foxp2 T A 6: 15,409,939 S513T possibly damaging Het
Gm5600 G T 7: 113,707,804 noncoding transcript Het
Haspin A G 11: 73,136,085 I726T probably benign Het
Lama4 T A 10: 39,042,567 probably null Het
Lrrc7 A T 3: 158,170,661 H597Q probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Plcb4 C T 2: 135,939,973 T238M probably damaging Het
Prph C G 15: 99,055,282 probably benign Het
Rassf2 C T 2: 132,000,432 probably null Het
Saal1 A G 7: 46,692,811 F403L probably benign Het
Serpina3a C T 12: 104,116,499 T177I probably benign Het
Slc23a2 C T 2: 132,094,195 E52K possibly damaging Het
Stab2 T A 10: 86,954,474 probably null Het
Syne3 T A 12: 104,969,234 E95V probably damaging Het
Vmn1r58 G T 7: 5,410,940 T97N probably damaging Het
Vmn2r61 T G 7: 42,266,863 L300W probably damaging Het
Vps13a T C 19: 16,743,057 E388G possibly damaging Het
Other mutations in Plekhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02882:Plekhd1 APN 12 80719007 critical splice donor site probably null
R0377:Plekhd1 UTSW 12 80706436 splice site probably benign
R0462:Plekhd1 UTSW 12 80721578 missense probably damaging 1.00
R0626:Plekhd1 UTSW 12 80717301 missense probably damaging 1.00
R1125:Plekhd1 UTSW 12 80707224 missense possibly damaging 0.83
R1344:Plekhd1 UTSW 12 80692885 missense probably benign
R1418:Plekhd1 UTSW 12 80692885 missense probably benign
R1694:Plekhd1 UTSW 12 80722321 missense possibly damaging 0.90
R2070:Plekhd1 UTSW 12 80692907 nonsense probably null
R2073:Plekhd1 UTSW 12 80721292 missense probably benign 0.19
R2231:Plekhd1 UTSW 12 80721951 missense possibly damaging 0.74
R3615:Plekhd1 UTSW 12 80717270 missense probably damaging 1.00
R3616:Plekhd1 UTSW 12 80717270 missense probably damaging 1.00
R4899:Plekhd1 UTSW 12 80722327 missense probably damaging 1.00
R4955:Plekhd1 UTSW 12 80722021 missense possibly damaging 0.54
R5028:Plekhd1 UTSW 12 80692949 missense probably damaging 1.00
R5446:Plekhd1 UTSW 12 80720636 missense probably benign 0.00
R5615:Plekhd1 UTSW 12 80720590 missense probably damaging 1.00
R5648:Plekhd1 UTSW 12 80720588 missense probably damaging 1.00
R5766:Plekhd1 UTSW 12 80722366 missense probably benign
R6534:Plekhd1 UTSW 12 80707257 missense probably damaging 0.99
R7003:Plekhd1 UTSW 12 80721960 missense possibly damaging 0.92
R7615:Plekhd1 UTSW 12 80722445 missense probably benign 0.02
R7656:Plekhd1 UTSW 12 80722160 splice site probably null
R8348:Plekhd1 UTSW 12 80706375 missense probably damaging 0.97
R8448:Plekhd1 UTSW 12 80706375 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACCAAGCCAGTACTTAGGAGG -3'
(R):5'- TGCCCATGAATAGCATCCCC -3'

Sequencing Primer
(F):5'- CCAAGCCAGTACTTAGGAGGAGAAG -3'
(R):5'- CCCCATGCTGAGCCCAC -3'
Posted On2014-10-30