Incidental Mutation 'R2326:Serpina3a'
ID244930
Institutional Source Beutler Lab
Gene Symbol Serpina3a
Ensembl Gene ENSMUSG00000041536
Gene Nameserine (or cysteine) peptidase inhibitor, clade A, member 3A
Synonyms4933406L18Rik, antitrypsin, alpha-1 antiproteinase,
MMRRC Submission 040317-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R2326 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location104112724-104121896 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 104116499 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 177 (T177I)
Ref Sequence ENSEMBL: ENSMUSP00000140024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021496] [ENSMUST00000109965] [ENSMUST00000185595]
Predicted Effect probably benign
Transcript: ENSMUST00000021496
AA Change: T177I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000021496
Gene: ENSMUSG00000041536
AA Change: T177I

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SERPIN 58 419 1.73e-151 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109965
SMART Domains Protein: ENSMUSP00000105591
Gene: ENSMUSG00000041536

DomainStartEndE-ValueType
SERPIN 4 229 5.39e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185595
AA Change: T177I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000140024
Gene: ENSMUSG00000041536
AA Change: T177I

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SERPIN 58 419 1.73e-151 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bglap3 G C 3: 88,369,512 probably benign Het
Cdh3 A G 8: 106,511,308 T45A probably benign Het
Cdyl2 A G 8: 116,623,798 V198A probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp7a1 A T 4: 6,268,396 I443K probably benign Het
Dazap1 T A 10: 80,284,233 M234K possibly damaging Het
Dnmt1 A T 9: 20,924,146 probably benign Het
Dusp8 A G 7: 142,090,063 Y38H probably damaging Het
Ewsr1 A G 11: 5,091,857 probably null Het
Fem1b T C 9: 62,797,003 H325R probably damaging Het
Flrt3 C A 2: 140,661,391 V106F possibly damaging Het
Foxp2 T A 6: 15,409,939 S513T possibly damaging Het
Gm5600 G T 7: 113,707,804 noncoding transcript Het
Haspin A G 11: 73,136,085 I726T probably benign Het
Lama4 T A 10: 39,042,567 probably null Het
Lrrc7 A T 3: 158,170,661 H597Q probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Plcb4 C T 2: 135,939,973 T238M probably damaging Het
Plekhd1 A G 12: 80,722,099 probably null Het
Prph C G 15: 99,055,282 probably benign Het
Rassf2 C T 2: 132,000,432 probably null Het
Saal1 A G 7: 46,692,811 F403L probably benign Het
Slc23a2 C T 2: 132,094,195 E52K possibly damaging Het
Stab2 T A 10: 86,954,474 probably null Het
Syne3 T A 12: 104,969,234 E95V probably damaging Het
Vmn1r58 G T 7: 5,410,940 T97N probably damaging Het
Vmn2r61 T G 7: 42,266,863 L300W probably damaging Het
Vps13a T C 19: 16,743,057 E388G possibly damaging Het
Other mutations in Serpina3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Serpina3a APN 12 104121499 missense probably benign 0.05
IGL02003:Serpina3a APN 12 104116000 missense probably benign 0.02
IGL02379:Serpina3a APN 12 104118660 missense probably benign 0.00
IGL02547:Serpina3a APN 12 104116543 missense probably damaging 0.98
IGL02593:Serpina3a APN 12 104118432 missense probably benign 0.01
IGL02730:Serpina3a APN 12 104119663 missense probably damaging 1.00
IGL02953:Serpina3a APN 12 104116489 missense probably benign 0.00
IGL03197:Serpina3a APN 12 104116241 missense probably damaging 1.00
R1184:Serpina3a UTSW 12 104116528 nonsense probably null
R1635:Serpina3a UTSW 12 104116478 missense probably damaging 1.00
R1688:Serpina3a UTSW 12 104118643 missense probably benign 0.06
R1804:Serpina3a UTSW 12 104118416 splice site probably benign
R1867:Serpina3a UTSW 12 104118627 missense probably benign 0.01
R1888:Serpina3a UTSW 12 104116103 missense probably benign 0.16
R1888:Serpina3a UTSW 12 104116103 missense probably benign 0.16
R2110:Serpina3a UTSW 12 104116222 missense probably damaging 0.97
R2111:Serpina3a UTSW 12 104116222 missense probably damaging 0.97
R2305:Serpina3a UTSW 12 104116528 missense probably benign 0.05
R2405:Serpina3a UTSW 12 104121318 missense possibly damaging 0.50
R4008:Serpina3a UTSW 12 104118643 missense probably benign 0.06
R4010:Serpina3a UTSW 12 104118643 missense probably benign 0.06
R4011:Serpina3a UTSW 12 104118643 missense probably benign 0.06
R4079:Serpina3a UTSW 12 104119675 nonsense probably null
R4091:Serpina3a UTSW 12 104116366 missense probably benign 0.01
R4092:Serpina3a UTSW 12 104116366 missense probably benign 0.01
R4210:Serpina3a UTSW 12 104118643 missense probably benign 0.06
R5064:Serpina3a UTSW 12 104116189 missense probably benign 0.01
R6242:Serpina3a UTSW 12 104116001 missense probably benign 0.10
R6337:Serpina3a UTSW 12 104112878 missense probably benign 0.36
R6395:Serpina3a UTSW 12 104116451 missense probably damaging 0.99
R6683:Serpina3a UTSW 12 104119637 missense probably benign 0.16
R6994:Serpina3a UTSW 12 104112830 splice site probably null
R7117:Serpina3a UTSW 12 104116177 missense possibly damaging 0.95
R8104:Serpina3a UTSW 12 104112851 start gained probably benign
R8131:Serpina3a UTSW 12 104116208 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTCTCAAGTTCAATCTCACAGAG -3'
(R):5'- AGTGATCAGTGGTTCCCAGC -3'

Sequencing Primer
(F):5'- TCCACCAGAACTTTGGGC -3'
(R):5'- GATCAGTGGTTCCCAGCCAATATC -3'
Posted On2014-10-30