Incidental Mutation 'R2326:Syne3'
ID244931
Institutional Source Beutler Lab
Gene Symbol Syne3
Ensembl Gene ENSMUSG00000054150
Gene Namespectrin repeat containing, nuclear envelope family member 3
Synonyms4831426I19Rik, nesprin-3, nesprin-3alpha, nesprin-3beta
MMRRC Submission 040317-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2326 (G1)
Quality Score217
Status Validated
Chromosome12
Chromosomal Location104929933-105009809 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104969234 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 95 (E95V)
Ref Sequence ENSEMBL: ENSMUSP00000093090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067005] [ENSMUST00000095439] [ENSMUST00000109927]
Predicted Effect probably benign
Transcript: ENSMUST00000067005
SMART Domains Protein: ENSMUSP00000065771
Gene: ENSMUSG00000054150

DomainStartEndE-ValueType
Blast:SPEC 29 127 8e-24 BLAST
SPEC 136 237 1.01e-1 SMART
Blast:SPEC 252 446 9e-55 BLAST
low complexity region 447 459 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
SPEC 563 664 1.74e-1 SMART
Blast:SPEC 722 818 1e-12 BLAST
KASH 832 888 7.52e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095439
AA Change: E95V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093090
Gene: ENSMUSG00000054150
AA Change: E95V

DomainStartEndE-ValueType
SPEC 7 109 1.22e-1 SMART
SPEC 223 324 1.01e-1 SMART
Blast:SPEC 339 533 2e-54 BLAST
low complexity region 534 546 N/A INTRINSIC
low complexity region 582 601 N/A INTRINSIC
SPEC 650 751 1.74e-1 SMART
Blast:SPEC 809 905 1e-12 BLAST
KASH 919 975 7.52e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109927
SMART Domains Protein: ENSMUSP00000105553
Gene: ENSMUSG00000054150

DomainStartEndE-ValueType
Blast:SPEC 29 127 8e-24 BLAST
SPEC 136 237 1.01e-1 SMART
Blast:SPEC 252 446 9e-55 BLAST
low complexity region 447 459 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
SPEC 563 664 1.74e-1 SMART
Blast:SPEC 722 818 1e-12 BLAST
KASH 832 888 7.52e-24 SMART
Meta Mutation Damage Score 0.4744 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bglap3 G C 3: 88,369,512 probably benign Het
Cdh3 A G 8: 106,511,308 T45A probably benign Het
Cdyl2 A G 8: 116,623,798 V198A probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp7a1 A T 4: 6,268,396 I443K probably benign Het
Dazap1 T A 10: 80,284,233 M234K possibly damaging Het
Dnmt1 A T 9: 20,924,146 probably benign Het
Dusp8 A G 7: 142,090,063 Y38H probably damaging Het
Ewsr1 A G 11: 5,091,857 probably null Het
Fem1b T C 9: 62,797,003 H325R probably damaging Het
Flrt3 C A 2: 140,661,391 V106F possibly damaging Het
Foxp2 T A 6: 15,409,939 S513T possibly damaging Het
Gm5600 G T 7: 113,707,804 noncoding transcript Het
Haspin A G 11: 73,136,085 I726T probably benign Het
Lama4 T A 10: 39,042,567 probably null Het
Lrrc7 A T 3: 158,170,661 H597Q probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Plcb4 C T 2: 135,939,973 T238M probably damaging Het
Plekhd1 A G 12: 80,722,099 probably null Het
Prph C G 15: 99,055,282 probably benign Het
Rassf2 C T 2: 132,000,432 probably null Het
Saal1 A G 7: 46,692,811 F403L probably benign Het
Serpina3a C T 12: 104,116,499 T177I probably benign Het
Slc23a2 C T 2: 132,094,195 E52K possibly damaging Het
Stab2 T A 10: 86,954,474 probably null Het
Vmn1r58 G T 7: 5,410,940 T97N probably damaging Het
Vmn2r61 T G 7: 42,266,863 L300W probably damaging Het
Vps13a T C 19: 16,743,057 E388G possibly damaging Het
Other mutations in Syne3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Syne3 APN 12 104958069 missense probably benign 0.00
IGL01986:Syne3 APN 12 104968000 missense probably damaging 1.00
IGL02303:Syne3 APN 12 104963294 missense probably damaging 1.00
IGL02469:Syne3 APN 12 104954306 missense probably benign 0.08
IGL03127:Syne3 APN 12 104943428 missense probably benign 0.02
BB008:Syne3 UTSW 12 104963232 missense probably damaging 0.97
BB018:Syne3 UTSW 12 104963232 missense probably damaging 0.97
PIT4791001:Syne3 UTSW 12 104963179 missense probably benign
R0436:Syne3 UTSW 12 104946924 missense possibly damaging 0.95
R0471:Syne3 UTSW 12 104943426 missense probably benign 0.00
R0613:Syne3 UTSW 12 104958112 missense probably benign
R0662:Syne3 UTSW 12 104961510 missense probably benign 0.44
R0707:Syne3 UTSW 12 104969360 missense probably damaging 0.98
R1321:Syne3 UTSW 12 104975796 missense probably benign 0.14
R1494:Syne3 UTSW 12 104955582 missense possibly damaging 0.87
R2035:Syne3 UTSW 12 104958127 missense probably benign 0.00
R2147:Syne3 UTSW 12 104953098 missense probably damaging 1.00
R2923:Syne3 UTSW 12 104968084 missense probably damaging 1.00
R3710:Syne3 UTSW 12 104943438 missense possibly damaging 0.86
R3946:Syne3 UTSW 12 104958066 missense probably damaging 1.00
R4542:Syne3 UTSW 12 104969244 missense probably benign 0.00
R4544:Syne3 UTSW 12 104959469 missense probably damaging 1.00
R5110:Syne3 UTSW 12 104943370 missense probably benign 0.10
R5256:Syne3 UTSW 12 104975880 start codon destroyed probably null 1.00
R5490:Syne3 UTSW 12 104955672 missense probably damaging 1.00
R5616:Syne3 UTSW 12 104955678 missense probably damaging 1.00
R5730:Syne3 UTSW 12 104961454 missense probably benign 0.02
R5941:Syne3 UTSW 12 104946992 missense probably benign
R6208:Syne3 UTSW 12 104943363 missense probably benign 0.12
R6456:Syne3 UTSW 12 104940704 missense possibly damaging 0.87
R6566:Syne3 UTSW 12 104946707 missense probably benign 0.00
R6957:Syne3 UTSW 12 104954302 missense probably damaging 1.00
R7251:Syne3 UTSW 12 104961571 frame shift probably null
R7388:Syne3 UTSW 12 104967908 missense probably damaging 1.00
R7591:Syne3 UTSW 12 104940604 critical splice donor site probably null
R7614:Syne3 UTSW 12 104946642 missense not run
R7740:Syne3 UTSW 12 104954287 missense probably benign 0.01
R7763:Syne3 UTSW 12 104997495 start gained probably benign
R7931:Syne3 UTSW 12 104963232 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CAAAGAGGGCATGCTGTTCC -3'
(R):5'- AGCCTTGAAATCCAGCTCTCG -3'

Sequencing Primer
(F):5'- TGTTCCCAGGACCCCTAAG -3'
(R):5'- TGGTGCCATGTCTGACCCTG -3'
Posted On2014-10-30