Incidental Mutation 'R2326:Crygs'
ID 244932
Institutional Source Beutler Lab
Gene Symbol Crygs
Ensembl Gene ENSMUSG00000033501
Gene Name crystallin, gamma S
Synonyms Opj
MMRRC Submission 040317-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2326 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 22623953-22630160 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 22624301 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 102 (G102D)
Ref Sequence ENSEMBL: ENSMUSP00000043588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040592]
AlphaFold O35486
PDB Structure NMR structure of murine gamma-S crystallin [SOLUTION NMR]
NMR structure of murine gamma-S crystallin [SOLUTION NMR]
NMR structure of murine gamma-S crystallin from joint refinement with SAXS data [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040592
AA Change: G102D

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000043588
Gene: ENSMUSG00000033501
AA Change: G102D

DomainStartEndE-ValueType
XTALbg 7 86 5.98e-40 SMART
XTALbg 95 176 6.26e-43 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. Since lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, making them extremely stable proteins. Mammalian lens crystallins are divided into alpha, beta, and gamma families; beta and gamma crystallins are also considered as a superfamily. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Gamma-crystallins are a homogeneous group of highly symmetrical, monomeric proteins typically lacking connecting peptides and terminal extensions. They are differentially regulated after early development. This gene encodes a protein initially considered to be a beta-crystallin but the encoded protein is monomeric and has greater sequence similarity to other gamma-crystallins. This gene encodes the most significant gamma-crystallin in adult eye lens tissue. Whether due to aging or mutations in specific genes, gamma-crystallins have been involved in cataract formation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene can cause cataracts and/or disrupted lens fiber cell morphology and organization. Aging mice homozygous for a knock-out allele do not develop cataracts but show focusing defects associated with inefficient clearance of cellular organelles and altered actin distribution. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bglap3 G C 3: 88,276,819 (GRCm39) probably benign Het
Cdh3 A G 8: 107,237,940 (GRCm39) T45A probably benign Het
Cdyl2 A G 8: 117,350,537 (GRCm39) V198A probably benign Het
Cyp7a1 A T 4: 6,268,396 (GRCm39) I443K probably benign Het
Dazap1 T A 10: 80,120,067 (GRCm39) M234K possibly damaging Het
Dnmt1 A T 9: 20,835,442 (GRCm39) probably benign Het
Dusp8 A G 7: 141,643,800 (GRCm39) Y38H probably damaging Het
Ewsr1 A G 11: 5,041,857 (GRCm39) probably null Het
Fem1b T C 9: 62,704,285 (GRCm39) H325R probably damaging Het
Flrt3 C A 2: 140,503,311 (GRCm39) V106F possibly damaging Het
Foxp2 T A 6: 15,409,938 (GRCm39) S513T possibly damaging Het
Gm5600 G T 7: 113,307,041 (GRCm39) noncoding transcript Het
Haspin A G 11: 73,026,911 (GRCm39) I726T probably benign Het
Lama4 T A 10: 38,918,563 (GRCm39) probably null Het
Lrrc7 A T 3: 157,876,298 (GRCm39) H597Q probably damaging Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Plcb4 C T 2: 135,781,893 (GRCm39) T238M probably damaging Het
Plekhd1 A G 12: 80,768,873 (GRCm39) probably null Het
Prph C G 15: 98,953,163 (GRCm39) probably benign Het
Rassf2 C T 2: 131,842,352 (GRCm39) probably null Het
Saal1 A G 7: 46,342,235 (GRCm39) F403L probably benign Het
Serpina3a C T 12: 104,082,758 (GRCm39) T177I probably benign Het
Slc23a2 C T 2: 131,936,115 (GRCm39) E52K possibly damaging Het
Stab2 T A 10: 86,790,338 (GRCm39) probably null Het
Syne3 T A 12: 104,935,493 (GRCm39) E95V probably damaging Het
Vmn1r58 G T 7: 5,413,939 (GRCm39) T97N probably damaging Het
Vmn2r61 T G 7: 41,916,287 (GRCm39) L300W probably damaging Het
Vps13a T C 19: 16,720,421 (GRCm39) E388G possibly damaging Het
Other mutations in Crygs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Crygs APN 16 22,625,312 (GRCm39) missense possibly damaging 0.81
R1694:Crygs UTSW 16 22,625,425 (GRCm39) splice site probably null
R1932:Crygs UTSW 16 22,625,304 (GRCm39) missense probably benign 0.12
R2206:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2207:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2275:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2298:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2299:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2300:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2329:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2330:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2331:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2332:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2857:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2895:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2896:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2921:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2922:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3120:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3196:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3427:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3609:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3611:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3625:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3693:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3694:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3695:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3870:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3871:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3876:Crygs UTSW 16 22,625,262 (GRCm39) missense probably damaging 1.00
R4052:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R4207:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R4299:Crygs UTSW 16 22,624,161 (GRCm39) nonsense probably null
R4630:Crygs UTSW 16 22,624,268 (GRCm39) missense possibly damaging 0.90
R7392:Crygs UTSW 16 22,625,252 (GRCm39) missense probably benign 0.35
R7573:Crygs UTSW 16 22,624,069 (GRCm39) makesense probably null
R7954:Crygs UTSW 16 22,624,082 (GRCm39) missense probably damaging 1.00
R7955:Crygs UTSW 16 22,624,082 (GRCm39) missense probably damaging 1.00
R7957:Crygs UTSW 16 22,624,082 (GRCm39) missense probably damaging 1.00
R8172:Crygs UTSW 16 22,625,292 (GRCm39) missense probably damaging 1.00
R9653:Crygs UTSW 16 22,625,304 (GRCm39) missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AGAACTCTATGGTCCCACTCC -3'
(R):5'- AGAGTTCTGATGACCCTCCC -3'

Sequencing Primer
(F):5'- TCACTCCACAATGCGGCG -3'
(R):5'- TGATGACCCTCCCTTAAGGATGAG -3'
Posted On 2014-10-30