Incidental Mutation 'R2274:Irf8'
ID244979
Institutional Source Beutler Lab
Gene Symbol Irf8
Ensembl Gene ENSMUSG00000041515
Gene Nameinterferon regulatory factor 8
SynonymsIcsbp1, ICSBP, Myls, IRF-8
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2274 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location120736358-120756694 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120753527 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 168 (E168G)
Ref Sequence ENSEMBL: ENSMUSP00000125447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047737] [ENSMUST00000127664] [ENSMUST00000160943] [ENSMUST00000162001] [ENSMUST00000162658]
Predicted Effect probably benign
Transcript: ENSMUST00000047737
AA Change: E259G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000040245
Gene: ENSMUSG00000041515
AA Change: E259G

DomainStartEndE-ValueType
IRF 3 115 8.69e-65 SMART
Blast:IRF 129 176 7e-11 BLAST
IRF-3 202 380 2.63e-78 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160594
Predicted Effect probably damaging
Transcript: ENSMUST00000160943
AA Change: E168G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125447
Gene: ENSMUSG00000041515
AA Change: E168G

DomainStartEndE-ValueType
IRF 3 85 2.54e-16 SMART
IRF-3 111 289 2.63e-78 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162001
AA Change: E259G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000125029
Gene: ENSMUSG00000041515
AA Change: E259G

DomainStartEndE-ValueType
IRF 3 115 8.69e-65 SMART
Blast:IRF 129 176 7e-11 BLAST
IRF-3 202 380 2.63e-78 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162658
SMART Domains Protein: ENSMUSP00000125443
Gene: ENSMUSG00000041515

DomainStartEndE-ValueType
IRF 3 85 2.54e-16 SMART
Pfam:IRF-3 111 151 4.7e-9 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a transcription factor that belongs to the interferon regulatory factor family. Proteins belonging to this family have a DNA binding domain at the amino terminus that contains five well-conserved tryptophan-rich repeats. This domain recognizes DNA sequences similar to the interferon-stimulated response element. The protein encoded by this gene promotes or suppresses lineage-specific genes to regulate the differentation of lymphoid and myeloid lineage cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit increased incidence of viral infections, shortened life span, deregulated hematopoiesis, and hematological neoplasias. Heterozygotes show similar, but milder, phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A T 11: 99,837,841 C59S possibly damaging Het
Abca5 A T 11: 110,275,281 N1556K possibly damaging Het
Abcb10 G T 8: 123,982,752 A21E probably benign Het
Ackr1 T C 1: 173,332,485 N156D probably benign Het
Adamtsl3 A T 7: 82,606,558 S1593C probably benign Het
Ank3 T A 10: 69,950,942 probably null Het
Aqp4 A G 18: 15,393,480 S315P probably benign Het
Atp7b T C 8: 22,020,832 I433V probably benign Het
Bco1 G A 8: 117,108,783 probably null Het
Cacna1g T A 11: 94,415,936 E1842V probably damaging Het
Calhm3 T A 19: 47,157,547 Q73L probably damaging Het
Car5a C T 8: 121,944,669 probably null Het
Cdk11b T A 4: 155,647,594 probably benign Het
Cdr2 A T 7: 120,958,509 H264Q possibly damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
D7Ertd443e A G 7: 134,270,201 S644P probably damaging Het
Dnlz A T 2: 26,351,471 C82S probably damaging Het
Egr4 A T 6: 85,512,743 F112I probably damaging Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
F11 T C 8: 45,252,147 D119G possibly damaging Het
Fat4 T A 3: 38,995,899 V3970D possibly damaging Het
Fbxw5 C A 2: 25,504,761 C222* probably null Het
Fn1 C T 1: 71,613,943 G1296R probably null Het
Ghr A G 15: 3,320,025 V557A probably benign Het
Gm11568 A G 11: 99,858,244 S92G unknown Het
Gpatch1 A T 7: 35,288,678 S678T probably benign Het
Gpr155 A G 2: 73,348,135 probably null Het
Gucy2f A T X: 142,116,273 M697K probably benign Het
Hecw1 T C 13: 14,346,068 T195A probably benign Het
Hoxd1 A G 2: 74,764,157 K252R probably damaging Het
Iqck G A 7: 118,899,657 D173N possibly damaging Het
Kcnh1 T G 1: 192,337,521 V358G probably damaging Het
Kifap3 T A 1: 163,868,758 V652D possibly damaging Het
L3hypdh T C 12: 72,084,858 Y100C possibly damaging Het
Map4k1 T A 7: 29,001,957 H729Q probably damaging Het
March1 T A 8: 66,387,499 N311K probably benign Het
Mier2 T C 10: 79,544,534 I321V probably damaging Het
Mta1 C T 12: 113,128,150 S291L probably damaging Het
Myh2 A G 11: 67,190,358 K1267E possibly damaging Het
Nbea A T 3: 55,988,085 probably null Het
Nexmif T G X: 104,087,846 E155A possibly damaging Het
Nkpd1 A G 7: 19,523,897 I534V probably benign Het
Nxph1 G T 6: 9,247,746 C239F probably damaging Het
Odc1 A G 12: 17,548,424 I189V probably benign Het
Olfr1170 A G 2: 88,224,823 F70L probably benign Het
Olfr314 T C 11: 58,786,666 V144A probably benign Het
Olfr351 A T 2: 36,860,101 N82K probably damaging Het
Olfr781 T C 10: 129,333,457 I192T probably benign Het
Pcdhb15 T C 18: 37,475,443 L576P probably damaging Het
Raph1 T C 1: 60,498,500 D499G probably damaging Het
Rptor T A 11: 119,756,322 C246* probably null Het
Rtl1 T C 12: 109,594,667 E246G unknown Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc12a3 T A 8: 94,333,287 I187N possibly damaging Het
Slc46a1 T G 11: 78,466,423 S101A probably benign Het
Slc4a8 A G 15: 100,807,402 M830V probably benign Het
Sned1 T A 1: 93,281,642 probably null Het
St3gal6 T A 16: 58,488,969 E34D possibly damaging Het
Tcstv3 C T 13: 120,317,654 Q30* probably null Het
Tex16 T A X: 112,121,141 D1112E probably damaging Het
Tmcc3 G A 10: 94,578,915 V160I probably damaging Het
Tmf1 T A 6: 97,163,586 L776F probably damaging Het
Tsr1 A T 11: 74,904,827 probably null Het
Tyrp1 A T 4: 80,837,534 E180V probably damaging Het
Ubr3 T C 2: 70,016,341 V1636A probably benign Het
Usp1 T C 4: 98,929,842 L139P probably damaging Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Vmn1r49 G A 6: 90,072,144 T292I probably benign Het
Wdr19 T A 5: 65,240,991 M853K possibly damaging Het
Zkscan8 C T 13: 21,521,796 M265I probably benign Het
Other mutations in Irf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01314:Irf8 APN 8 120753380 missense probably damaging 1.00
IGL02944:Irf8 APN 8 120755125 missense probably benign 0.00
IGL03024:Irf8 APN 8 120753358 missense probably damaging 0.98
gemini UTSW 8 120743883 nonsense probably null
gemini2 UTSW 8 120753707 missense probably damaging 0.97
glenn UTSW 8 120739842 missense probably damaging 1.00
ANU74:Irf8 UTSW 8 120739869 missense possibly damaging 0.75
R0211:Irf8 UTSW 8 120739975 missense probably damaging 1.00
R0211:Irf8 UTSW 8 120739975 missense probably damaging 1.00
R0840:Irf8 UTSW 8 120753481 missense probably benign 0.06
R1622:Irf8 UTSW 8 120739822 missense possibly damaging 0.86
R1715:Irf8 UTSW 8 120754388 missense probably damaging 0.98
R2875:Irf8 UTSW 8 120754463 missense probably damaging 1.00
R3743:Irf8 UTSW 8 120753571 missense probably damaging 1.00
R4209:Irf8 UTSW 8 120753469 missense probably damaging 0.99
R4729:Irf8 UTSW 8 120753439 missense probably damaging 0.99
R6343:Irf8 UTSW 8 120753707 missense probably damaging 0.97
R6950:Irf8 UTSW 8 120755125 missense probably benign 0.00
R7051:Irf8 UTSW 8 120739842 missense probably damaging 1.00
R7052:Irf8 UTSW 8 120739842 missense probably damaging 1.00
R7249:Irf8 UTSW 8 120739832 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACAGCTTTCTCCCAGATGGTC -3'
(R):5'- CGAGGTGACTTGGTACTGAC -3'

Sequencing Primer
(F):5'- AGATGGTCATCAGCTTCTACTACGG -3'
(R):5'- TTGGTGTCAAAGACCTGCAC -3'
Posted On2014-10-30