Incidental Mutation 'R2274:Hecw1'
ID244999
Institutional Source Beutler Lab
Gene Symbol Hecw1
Ensembl Gene ENSMUSG00000021301
Gene NameHECT, C2 and WW domain containing E3 ubiquitin protein ligase 1
SynonymsE130207I19Rik, NEDL1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2274 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location14226438-14523228 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14346068 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 195 (T195A)
Ref Sequence ENSEMBL: ENSMUSP00000106145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110516]
Predicted Effect probably benign
Transcript: ENSMUST00000110516
AA Change: T195A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000106145
Gene: ENSMUSG00000021301
AA Change: T195A

DomainStartEndE-ValueType
Pfam:HECW_N 65 184 6.5e-62 PFAM
C2 206 317 1.02e-12 SMART
low complexity region 463 477 N/A INTRINSIC
low complexity region 497 512 N/A INTRINSIC
low complexity region 577 598 N/A INTRINSIC
low complexity region 677 704 N/A INTRINSIC
low complexity region 731 745 N/A INTRINSIC
WW 827 859 8.66e-13 SMART
coiled coil region 873 898 N/A INTRINSIC
low complexity region 917 930 N/A INTRINSIC
WW 1017 1049 5.59e-7 SMART
Blast:HECTc 1137 1192 3e-26 BLAST
low complexity region 1193 1208 N/A INTRINSIC
low complexity region 1212 1223 N/A INTRINSIC
HECTc 1267 1604 1.36e-185 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221863
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222904
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223317
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A T 11: 99,837,841 C59S possibly damaging Het
Abca5 A T 11: 110,275,281 N1556K possibly damaging Het
Abcb10 G T 8: 123,982,752 A21E probably benign Het
Ackr1 T C 1: 173,332,485 N156D probably benign Het
Adamtsl3 A T 7: 82,606,558 S1593C probably benign Het
Ank3 T A 10: 69,950,942 probably null Het
Aqp4 A G 18: 15,393,480 S315P probably benign Het
Atp7b T C 8: 22,020,832 I433V probably benign Het
Bco1 G A 8: 117,108,783 probably null Het
Cacna1g T A 11: 94,415,936 E1842V probably damaging Het
Calhm3 T A 19: 47,157,547 Q73L probably damaging Het
Car5a C T 8: 121,944,669 probably null Het
Cdk11b T A 4: 155,647,594 probably benign Het
Cdr2 A T 7: 120,958,509 H264Q possibly damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
D7Ertd443e A G 7: 134,270,201 S644P probably damaging Het
Dnlz A T 2: 26,351,471 C82S probably damaging Het
Egr4 A T 6: 85,512,743 F112I probably damaging Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
F11 T C 8: 45,252,147 D119G possibly damaging Het
Fat4 T A 3: 38,995,899 V3970D possibly damaging Het
Fbxw5 C A 2: 25,504,761 C222* probably null Het
Fn1 C T 1: 71,613,943 G1296R probably null Het
Ghr A G 15: 3,320,025 V557A probably benign Het
Gm11568 A G 11: 99,858,244 S92G unknown Het
Gpatch1 A T 7: 35,288,678 S678T probably benign Het
Gpr155 A G 2: 73,348,135 probably null Het
Gucy2f A T X: 142,116,273 M697K probably benign Het
Hoxd1 A G 2: 74,764,157 K252R probably damaging Het
Iqck G A 7: 118,899,657 D173N possibly damaging Het
Irf8 A G 8: 120,753,527 E168G probably damaging Het
Kcnh1 T G 1: 192,337,521 V358G probably damaging Het
Kifap3 T A 1: 163,868,758 V652D possibly damaging Het
L3hypdh T C 12: 72,084,858 Y100C possibly damaging Het
Map4k1 T A 7: 29,001,957 H729Q probably damaging Het
March1 T A 8: 66,387,499 N311K probably benign Het
Mier2 T C 10: 79,544,534 I321V probably damaging Het
Mta1 C T 12: 113,128,150 S291L probably damaging Het
Myh2 A G 11: 67,190,358 K1267E possibly damaging Het
Nbea A T 3: 55,988,085 probably null Het
Nexmif T G X: 104,087,846 E155A possibly damaging Het
Nkpd1 A G 7: 19,523,897 I534V probably benign Het
Nxph1 G T 6: 9,247,746 C239F probably damaging Het
Odc1 A G 12: 17,548,424 I189V probably benign Het
Olfr1170 A G 2: 88,224,823 F70L probably benign Het
Olfr314 T C 11: 58,786,666 V144A probably benign Het
Olfr351 A T 2: 36,860,101 N82K probably damaging Het
Olfr781 T C 10: 129,333,457 I192T probably benign Het
Pcdhb15 T C 18: 37,475,443 L576P probably damaging Het
Raph1 T C 1: 60,498,500 D499G probably damaging Het
Rptor T A 11: 119,756,322 C246* probably null Het
Rtl1 T C 12: 109,594,667 E246G unknown Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc12a3 T A 8: 94,333,287 I187N possibly damaging Het
Slc46a1 T G 11: 78,466,423 S101A probably benign Het
Slc4a8 A G 15: 100,807,402 M830V probably benign Het
Sned1 T A 1: 93,281,642 probably null Het
St3gal6 T A 16: 58,488,969 E34D possibly damaging Het
Tcstv3 C T 13: 120,317,654 Q30* probably null Het
Tex16 T A X: 112,121,141 D1112E probably damaging Het
Tmcc3 G A 10: 94,578,915 V160I probably damaging Het
Tmf1 T A 6: 97,163,586 L776F probably damaging Het
Tsr1 A T 11: 74,904,827 probably null Het
Tyrp1 A T 4: 80,837,534 E180V probably damaging Het
Ubr3 T C 2: 70,016,341 V1636A probably benign Het
Usp1 T C 4: 98,929,842 L139P probably damaging Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Vmn1r49 G A 6: 90,072,144 T292I probably benign Het
Wdr19 T A 5: 65,240,991 M853K possibly damaging Het
Zkscan8 C T 13: 21,521,796 M265I probably benign Het
Other mutations in Hecw1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Hecw1 APN 13 14265980 missense possibly damaging 0.71
IGL00813:Hecw1 APN 13 14278376 critical splice acceptor site probably null
IGL00843:Hecw1 APN 13 14247573 missense probably benign 0.02
IGL00942:Hecw1 APN 13 14340740 splice site probably benign
IGL00976:Hecw1 APN 13 14318972 missense probably damaging 1.00
IGL01289:Hecw1 APN 13 14264134 missense probably damaging 1.00
IGL01675:Hecw1 APN 13 14234422 missense probably damaging 1.00
IGL01783:Hecw1 APN 13 14278293 missense probably damaging 1.00
IGL01941:Hecw1 APN 13 14316310 missense probably benign 0.01
IGL02170:Hecw1 APN 13 14264158 missense possibly damaging 0.75
IGL02172:Hecw1 APN 13 14264149 missense probably damaging 1.00
IGL02214:Hecw1 APN 13 14300393 missense probably damaging 1.00
IGL02350:Hecw1 APN 13 14248338 splice site probably null
IGL02357:Hecw1 APN 13 14248338 splice site probably null
IGL02372:Hecw1 APN 13 14264121 missense probably damaging 1.00
IGL02591:Hecw1 APN 13 14357236 splice site probably benign
IGL02718:Hecw1 APN 13 14306935 critical splice acceptor site probably null
IGL02795:Hecw1 APN 13 14322517 missense probably damaging 1.00
IGL02941:Hecw1 APN 13 14377726 missense probably damaging 1.00
IGL03256:Hecw1 APN 13 14280484 missense probably damaging 0.99
IGL03256:Hecw1 APN 13 14280485 missense probably benign 0.36
IGL03366:Hecw1 APN 13 14377797 missense probably damaging 1.00
deflated UTSW 13 14247620 missense possibly damaging 0.69
Demoralized UTSW 13 14316818 nonsense probably null
Letdown UTSW 13 14316492 missense probably benign 0.40
BB001:Hecw1 UTSW 13 14322528 missense probably damaging 1.00
BB011:Hecw1 UTSW 13 14322528 missense probably damaging 1.00
IGL03014:Hecw1 UTSW 13 14245808 missense probably damaging 1.00
PIT4378001:Hecw1 UTSW 13 14377783 missense probably damaging 0.98
R0555:Hecw1 UTSW 13 14236941 missense probably damaging 1.00
R0617:Hecw1 UTSW 13 14280442 missense probably benign 0.44
R1476:Hecw1 UTSW 13 14306086 missense probably damaging 1.00
R1479:Hecw1 UTSW 13 14316492 missense probably benign 0.40
R1551:Hecw1 UTSW 13 14316943 missense probably damaging 1.00
R1579:Hecw1 UTSW 13 14377907 missense probably damaging 1.00
R1584:Hecw1 UTSW 13 14340743 critical splice donor site probably null
R1735:Hecw1 UTSW 13 14377765 missense probably null 0.09
R1872:Hecw1 UTSW 13 14280449 nonsense probably null
R1897:Hecw1 UTSW 13 14377940 missense probably damaging 1.00
R2054:Hecw1 UTSW 13 14297413 missense probably damaging 0.97
R2085:Hecw1 UTSW 13 14264087 missense possibly damaging 0.93
R2134:Hecw1 UTSW 13 14377700 missense probably damaging 1.00
R2172:Hecw1 UTSW 13 14377706 missense probably damaging 1.00
R2258:Hecw1 UTSW 13 14316138 missense probably benign 0.01
R2275:Hecw1 UTSW 13 14346068 missense probably benign 0.00
R2937:Hecw1 UTSW 13 14245836 missense possibly damaging 0.93
R3830:Hecw1 UTSW 13 14346058 missense probably benign 0.13
R3971:Hecw1 UTSW 13 14236929 missense probably damaging 1.00
R4065:Hecw1 UTSW 13 14316431 missense probably damaging 1.00
R4066:Hecw1 UTSW 13 14316431 missense probably damaging 1.00
R4235:Hecw1 UTSW 13 14317139 missense probably benign 0.42
R4366:Hecw1 UTSW 13 14316164 missense probably damaging 1.00
R4382:Hecw1 UTSW 13 14316164 missense probably damaging 1.00
R4385:Hecw1 UTSW 13 14316164 missense probably damaging 1.00
R4510:Hecw1 UTSW 13 14357191 missense probably damaging 1.00
R4511:Hecw1 UTSW 13 14357191 missense probably damaging 1.00
R4558:Hecw1 UTSW 13 14247605 missense probably damaging 0.99
R4804:Hecw1 UTSW 13 14305985 missense probably benign 0.00
R4854:Hecw1 UTSW 13 14316892 missense probably benign 0.00
R5104:Hecw1 UTSW 13 14340792 missense probably damaging 1.00
R5113:Hecw1 UTSW 13 14346029 missense possibly damaging 0.94
R5167:Hecw1 UTSW 13 14285657 missense probably damaging 1.00
R5392:Hecw1 UTSW 13 14245762 missense probably damaging 1.00
R5394:Hecw1 UTSW 13 14322589 missense probably damaging 1.00
R5504:Hecw1 UTSW 13 14340902 missense probably benign 0.04
R5764:Hecw1 UTSW 13 14322509 missense probably damaging 1.00
R6038:Hecw1 UTSW 13 14346062 missense probably benign 0.28
R6038:Hecw1 UTSW 13 14346062 missense probably benign 0.28
R6228:Hecw1 UTSW 13 14346038 missense probably damaging 1.00
R6247:Hecw1 UTSW 13 14234425 nonsense probably null
R6252:Hecw1 UTSW 13 14272079 missense probably damaging 0.98
R6291:Hecw1 UTSW 13 14523007 unclassified probably benign
R6321:Hecw1 UTSW 13 14522829 missense probably benign 0.00
R6325:Hecw1 UTSW 13 14316446 missense probably damaging 1.00
R6328:Hecw1 UTSW 13 14247620 missense possibly damaging 0.69
R6557:Hecw1 UTSW 13 14316646 missense possibly damaging 0.78
R6566:Hecw1 UTSW 13 14297283 missense probably damaging 1.00
R6597:Hecw1 UTSW 13 14316818 nonsense probably null
R6821:Hecw1 UTSW 13 14264134 missense probably damaging 1.00
R6914:Hecw1 UTSW 13 14316838 missense probably damaging 0.99
R7078:Hecw1 UTSW 13 14434459 start codon destroyed probably null 0.21
R7114:Hecw1 UTSW 13 14311771 missense probably benign 0.02
R7140:Hecw1 UTSW 13 14316533 missense probably benign
R7150:Hecw1 UTSW 13 14434460 start codon destroyed probably benign
R7288:Hecw1 UTSW 13 14316236 missense probably benign 0.00
R7447:Hecw1 UTSW 13 14357204 missense probably damaging 1.00
R7479:Hecw1 UTSW 13 14340840 missense probably damaging 1.00
R7552:Hecw1 UTSW 13 14316250 missense probably damaging 0.99
R7590:Hecw1 UTSW 13 14264083 missense probably damaging 1.00
R7787:Hecw1 UTSW 13 14318909 missense probably damaging 1.00
R7803:Hecw1 UTSW 13 14234342 missense probably benign 0.25
R7924:Hecw1 UTSW 13 14322528 missense probably damaging 1.00
R8195:Hecw1 UTSW 13 14306107 missense probably damaging 0.99
R8252:Hecw1 UTSW 13 14340840 missense probably damaging 1.00
RF001:Hecw1 UTSW 13 14297424 missense probably damaging 1.00
X0020:Hecw1 UTSW 13 14230723 missense possibly damaging 0.52
X0066:Hecw1 UTSW 13 14280460 missense probably benign 0.13
Z1176:Hecw1 UTSW 13 14300333 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TCACTGCACGTTCAGGTTC -3'
(R):5'- GGAGAAGAATTTCCCACAAGCC -3'

Sequencing Primer
(F):5'- CACATCAGCTGAGGCATTTG -3'
(R):5'- TTTCCCACAAGCCACAGAAGGG -3'
Posted On2014-10-30