Incidental Mutation 'R0278:H2-Q10'
ID24500
Institutional Source Beutler Lab
Gene Symbol H2-Q10
Ensembl Gene ENSMUSG00000067235
Gene Namehistocompatibility 2, Q region locus 10
SynonymsH-2Q10, Qa10, Q10
MMRRC Submission 038500-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0278 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location35470089-35474563 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 35473307 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 282 (T282S)
Ref Sequence ENSEMBL: ENSMUSP00000134163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068291] [ENSMUST00000174525]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068291
AA Change: T282S

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000066419
Gene: ENSMUSG00000067235
AA Change: T282S

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
Pfam:MHC_I 25 203 5.8e-98 PFAM
IGc1 222 293 8.23e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000174525
AA Change: T282S

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134163
Gene: ENSMUSG00000067235
AA Change: T282S

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
Pfam:MHC_I 25 203 3.3e-99 PFAM
IGc1 222 293 8.23e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174589
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.4%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Unlike other class I genes, this gene is expressed only in liver cells and its product is secreted into the serum. The amount of protein in serum varies among inbred strains with different H2 haplotypes and is completely absent in the H2f strain B10.M. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,378,215 S3429R probably damaging Het
Abca3 A G 17: 24,381,920 D436G probably benign Het
Acacb C A 5: 114,233,259 Y1816* probably null Het
Acer3 T C 7: 98,261,597 Y86C probably damaging Het
Adgre1 A G 17: 57,447,872 I657V probably benign Het
Akap1 A G 11: 88,845,194 V214A probably benign Het
Ankrd42 T C 7: 92,631,657 R22G possibly damaging Het
Apc2 C T 10: 80,312,813 P1234S possibly damaging Het
Atp13a4 A G 16: 29,454,834 I441T probably damaging Het
Cenpu G A 8: 46,578,309 A242T probably damaging Het
Col6a6 A T 9: 105,767,288 V1267E possibly damaging Het
Crhr2 T C 6: 55,117,531 T58A probably benign Het
Ddx6 T G 9: 44,631,425 C385G probably damaging Het
Dnah7a A T 1: 53,504,146 N2288K probably benign Het
Egfl8 A T 17: 34,614,368 probably null Het
Elmo2 A T 2: 165,297,367 I420N probably damaging Het
Elovl4 A G 9: 83,783,195 F113L probably benign Het
Fancd2 T A 6: 113,548,448 probably null Het
Fbxl13 A G 5: 21,523,910 V456A probably benign Het
Fgfr2 A T 7: 130,261,862 probably null Het
Fkbpl A T 17: 34,645,410 R51* probably null Het
Fn3krp G A 11: 121,421,580 V40M probably damaging Het
Fnip1 A G 11: 54,489,343 probably null Het
Gm15446 A T 5: 109,943,415 Q511L probably benign Het
Gm7334 A G 17: 50,699,261 K192E probably damaging Het
Hspa9 A G 18: 34,940,910 V482A possibly damaging Het
Ica1l A T 1: 60,013,996 S128T probably benign Het
Il7r A T 15: 9,516,337 I126K probably damaging Het
Kcnj8 T C 6: 142,570,348 E11G probably benign Het
Klkb1 A C 8: 45,272,409 F498V probably benign Het
Lama1 A G 17: 67,810,183 E2491G probably null Het
Lhfpl2 T C 13: 94,174,435 V71A probably benign Het
Lin9 T C 1: 180,665,923 I198T probably damaging Het
Lrrc7 T A 3: 158,179,795 M431L possibly damaging Het
Nmt2 A G 2: 3,325,387 T519A probably benign Het
Olfr1043 A T 2: 86,162,579 Y123* probably null Het
Olfr1247 A T 2: 89,609,763 L113Q probably damaging Het
Olfr1247 G T 2: 89,609,764 L113M probably damaging Het
Olfr1490 C A 19: 13,654,764 L112I probably damaging Het
Olfr1490 T A 19: 13,654,765 L112H probably damaging Het
Olfr412 T C 11: 74,365,202 F178L probably damaging Het
Olfr871 G T 9: 20,212,886 C179F probably damaging Het
Parp4 A G 14: 56,607,523 R624G probably damaging Het
Pex16 C T 2: 92,381,056 P325S probably damaging Het
Pik3ca T C 3: 32,439,753 M288T possibly damaging Het
Pla2g5 C T 4: 138,800,656 D100N probably benign Het
Prss43 T A 9: 110,827,362 M39K probably benign Het
Psd4 T C 2: 24,394,438 S105P probably damaging Het
Ptprz1 T A 6: 23,000,817 S969T probably benign Het
Rad23b T A 4: 55,383,575 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rpl10l A G 12: 66,284,356 M1T probably null Het
Sec16a A G 2: 26,428,316 S1588P probably damaging Het
Sh3rf1 A T 8: 61,374,018 H602L probably damaging Het
Sparcl1 A T 5: 104,088,397 S497T probably benign Het
Spata13 A G 14: 60,692,088 Y365C probably benign Het
Trim5 T C 7: 104,279,675 N20D probably benign Het
Vmn1r201 G T 13: 22,475,024 W136L probably damaging Het
Vmn2r112 A G 17: 22,603,006 I222V probably benign Het
Vmn2r56 A T 7: 12,715,717 V198D probably damaging Het
Wapl A G 14: 34,692,612 D477G possibly damaging Het
Zfp202 C A 9: 40,208,482 H194N probably benign Het
Zfp212 C T 6: 47,926,519 R13W probably damaging Het
Other mutations in H2-Q10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01893:H2-Q10 APN 17 35473271 missense probably damaging 1.00
IGL02003:H2-Q10 APN 17 35470441 missense probably benign 0.01
IGL02308:H2-Q10 APN 17 35473566 makesense probably null
IGL02804:H2-Q10 APN 17 35473250 missense probably damaging 1.00
gomez UTSW 17 35474020 utr 3 prime probably benign
lurch UTSW 17 35471018 missense possibly damaging 0.92
R1679:H2-Q10 UTSW 17 35473595 utr 3 prime probably benign
R1919:H2-Q10 UTSW 17 35470488 missense probably damaging 1.00
R3781:H2-Q10 UTSW 17 35471018 missense possibly damaging 0.92
R3782:H2-Q10 UTSW 17 35471018 missense possibly damaging 0.92
R4614:H2-Q10 UTSW 17 35474020 utr 3 prime probably benign
R4814:H2-Q10 UTSW 17 35473584 utr 3 prime probably benign
R4870:H2-Q10 UTSW 17 35470460 missense probably damaging 1.00
R6063:H2-Q10 UTSW 17 35470129 missense probably benign 0.13
R7448:H2-Q10 UTSW 17 35473560 missense not run
R7728:H2-Q10 UTSW 17 35470838 missense probably damaging 0.98
R8034:H2-Q10 UTSW 17 35470441 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACCCATCACCCAGGATCTGAAG -3'
(R):5'- GCAGACCCAGTTTGAGTCAGTAGC -3'

Sequencing Primer
(F):5'- CACCCAGGATCTGAAGGTGATG -3'
(R):5'- CCAGTTTGAGTCAGTAGCAATGTG -3'
Posted On2013-04-16