Incidental Mutation 'R2274:Ghr'
ID245002
Institutional Source Beutler Lab
Gene Symbol Ghr
Ensembl Gene ENSMUSG00000055737
Gene Namegrowth hormone receptor
SynonymsGHR/BP, GHBP
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2274 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location3317760-3583492 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3320025 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 557 (V557A)
Ref Sequence ENSEMBL: ENSMUSP00000124064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069451] [ENSMUST00000161561]
Predicted Effect probably benign
Transcript: ENSMUST00000069451
AA Change: V557A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000069457
Gene: ENSMUSG00000055737
AA Change: V557A

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 43 152 3.6e-12 PFAM
FN3 159 249 3.99e0 SMART
transmembrane domain 274 296 N/A INTRINSIC
Pfam:GHBP 325 636 2.1e-110 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161561
AA Change: V557A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000124064
Gene: ENSMUSG00000055737
AA Change: V557A

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 43 152 3.6e-12 PFAM
FN3 159 249 3.99e0 SMART
transmembrane domain 274 296 N/A INTRINSIC
Pfam:GHBP 325 628 1.8e-132 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type I cytokine receptor family, which is a transmembrane receptor for growth hormone. Binding of growth hormone to the receptor leads to receptor dimerization and the activation of an intra- and intercellular signal transduction pathway leading to growth. Mutations in this gene have been associated with Laron syndrome, also known as the growth hormone insensitivity syndrome (GHIS), a disorder characterized by short stature. In humans and rabbits, but not rodents, growth hormone binding protein (GHBP) is generated by proteolytic cleavage of the extracellular ligand-binding domain from the mature growth hormone receptor protein. Multiple alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit retarded postnatal growth, proportionate dwarfism, decreased plasma insulin-like growth factor I levels, small pituitaries, reduced fecundity in females, and extended life-span. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A T 11: 99,837,841 C59S possibly damaging Het
Abca5 A T 11: 110,275,281 N1556K possibly damaging Het
Abcb10 G T 8: 123,982,752 A21E probably benign Het
Ackr1 T C 1: 173,332,485 N156D probably benign Het
Adamtsl3 A T 7: 82,606,558 S1593C probably benign Het
Ank3 T A 10: 69,950,942 probably null Het
Aqp4 A G 18: 15,393,480 S315P probably benign Het
Atp7b T C 8: 22,020,832 I433V probably benign Het
Bco1 G A 8: 117,108,783 probably null Het
Cacna1g T A 11: 94,415,936 E1842V probably damaging Het
Calhm3 T A 19: 47,157,547 Q73L probably damaging Het
Car5a C T 8: 121,944,669 probably null Het
Cdk11b T A 4: 155,647,594 probably benign Het
Cdr2 A T 7: 120,958,509 H264Q possibly damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
D7Ertd443e A G 7: 134,270,201 S644P probably damaging Het
Dnlz A T 2: 26,351,471 C82S probably damaging Het
Egr4 A T 6: 85,512,743 F112I probably damaging Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
F11 T C 8: 45,252,147 D119G possibly damaging Het
Fat4 T A 3: 38,995,899 V3970D possibly damaging Het
Fbxw5 C A 2: 25,504,761 C222* probably null Het
Fn1 C T 1: 71,613,943 G1296R probably null Het
Gm11568 A G 11: 99,858,244 S92G unknown Het
Gpatch1 A T 7: 35,288,678 S678T probably benign Het
Gpr155 A G 2: 73,348,135 probably null Het
Gucy2f A T X: 142,116,273 M697K probably benign Het
Hecw1 T C 13: 14,346,068 T195A probably benign Het
Hoxd1 A G 2: 74,764,157 K252R probably damaging Het
Iqck G A 7: 118,899,657 D173N possibly damaging Het
Irf8 A G 8: 120,753,527 E168G probably damaging Het
Kcnh1 T G 1: 192,337,521 V358G probably damaging Het
Kifap3 T A 1: 163,868,758 V652D possibly damaging Het
L3hypdh T C 12: 72,084,858 Y100C possibly damaging Het
Map4k1 T A 7: 29,001,957 H729Q probably damaging Het
March1 T A 8: 66,387,499 N311K probably benign Het
Mier2 T C 10: 79,544,534 I321V probably damaging Het
Mta1 C T 12: 113,128,150 S291L probably damaging Het
Myh2 A G 11: 67,190,358 K1267E possibly damaging Het
Nbea A T 3: 55,988,085 probably null Het
Nexmif T G X: 104,087,846 E155A possibly damaging Het
Nkpd1 A G 7: 19,523,897 I534V probably benign Het
Nxph1 G T 6: 9,247,746 C239F probably damaging Het
Odc1 A G 12: 17,548,424 I189V probably benign Het
Olfr1170 A G 2: 88,224,823 F70L probably benign Het
Olfr314 T C 11: 58,786,666 V144A probably benign Het
Olfr351 A T 2: 36,860,101 N82K probably damaging Het
Olfr781 T C 10: 129,333,457 I192T probably benign Het
Pcdhb15 T C 18: 37,475,443 L576P probably damaging Het
Raph1 T C 1: 60,498,500 D499G probably damaging Het
Rptor T A 11: 119,756,322 C246* probably null Het
Rtl1 T C 12: 109,594,667 E246G unknown Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc12a3 T A 8: 94,333,287 I187N possibly damaging Het
Slc46a1 T G 11: 78,466,423 S101A probably benign Het
Slc4a8 A G 15: 100,807,402 M830V probably benign Het
Sned1 T A 1: 93,281,642 probably null Het
St3gal6 T A 16: 58,488,969 E34D possibly damaging Het
Tcstv3 C T 13: 120,317,654 Q30* probably null Het
Tex16 T A X: 112,121,141 D1112E probably damaging Het
Tmcc3 G A 10: 94,578,915 V160I probably damaging Het
Tmf1 T A 6: 97,163,586 L776F probably damaging Het
Tsr1 A T 11: 74,904,827 probably null Het
Tyrp1 A T 4: 80,837,534 E180V probably damaging Het
Ubr3 T C 2: 70,016,341 V1636A probably benign Het
Usp1 T C 4: 98,929,842 L139P probably damaging Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Vmn1r49 G A 6: 90,072,144 T292I probably benign Het
Wdr19 T A 5: 65,240,991 M853K possibly damaging Het
Zkscan8 C T 13: 21,521,796 M265I probably benign Het
Other mutations in Ghr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Ghr APN 15 3328120 missense probably benign 0.00
IGL01366:Ghr APN 15 3320187 missense probably damaging 1.00
IGL01446:Ghr APN 15 3333355 missense probably damaging 1.00
IGL01730:Ghr APN 15 3320584 missense probably damaging 1.00
IGL01908:Ghr APN 15 3320447 nonsense probably null
IGL02396:Ghr APN 15 3457998 start codon destroyed probably null 0.99
IGL02476:Ghr APN 15 3320046 missense probably damaging 1.00
IGL02863:Ghr APN 15 3328102 nonsense probably null
IGL03338:Ghr APN 15 3347542 missense probably damaging 1.00
Elfin UTSW 15 3340927 missense probably damaging 0.98
garden UTSW 15 3347572 missense probably benign 0.00
gnome UTSW 15 3388646 critical splice donor site probably null
R0334:Ghr UTSW 15 3341098 splice site probably benign
R0387:Ghr UTSW 15 3319891 missense probably benign
R0581:Ghr UTSW 15 3388634 splice site probably benign
R1185:Ghr UTSW 15 3328062 missense possibly damaging 0.50
R1185:Ghr UTSW 15 3328062 missense possibly damaging 0.50
R1185:Ghr UTSW 15 3328062 missense possibly damaging 0.50
R1216:Ghr UTSW 15 3319855 missense probably damaging 1.00
R1294:Ghr UTSW 15 3388646 critical splice donor site probably null
R1607:Ghr UTSW 15 3320574 missense probably damaging 1.00
R1743:Ghr UTSW 15 3320241 missense probably benign 0.06
R2006:Ghr UTSW 15 3327982 missense probably damaging 0.98
R2197:Ghr UTSW 15 3333474 nonsense probably null
R2332:Ghr UTSW 15 3320409 missense probably benign 0.16
R4283:Ghr UTSW 15 3333448 missense possibly damaging 0.73
R4519:Ghr UTSW 15 3333488 missense probably damaging 1.00
R4521:Ghr UTSW 15 3325958 missense probably damaging 1.00
R4714:Ghr UTSW 15 3320397 missense possibly damaging 0.91
R4717:Ghr UTSW 15 3319753 missense possibly damaging 0.81
R4724:Ghr UTSW 15 3325940 missense probably benign 0.31
R5087:Ghr UTSW 15 3320140 missense probably damaging 1.00
R5269:Ghr UTSW 15 3320079 missense probably benign 0.16
R5429:Ghr UTSW 15 3388675 nonsense probably null
R6012:Ghr UTSW 15 3340927 missense probably damaging 0.98
R6135:Ghr UTSW 15 3325965 missense probably benign 0.04
R6588:Ghr UTSW 15 3320268 missense probably benign 0.14
R7069:Ghr UTSW 15 3320484 missense probably damaging 1.00
R7074:Ghr UTSW 15 3333391 missense probably damaging 1.00
R7408:Ghr UTSW 15 3347572 missense probably benign 0.00
R7540:Ghr UTSW 15 3319914 missense possibly damaging 0.72
R7575:Ghr UTSW 15 3320512 missense probably damaging 1.00
R7822:Ghr UTSW 15 3457957 missense probably benign 0.00
R7922:Ghr UTSW 15 3341074 missense possibly damaging 0.56
R8221:Ghr UTSW 15 3333419 missense probably benign 0.37
X0017:Ghr UTSW 15 3320694 missense probably damaging 1.00
X0064:Ghr UTSW 15 3320212 missense possibly damaging 0.90
Z1176:Ghr UTSW 15 3347485 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GAGTATAAGGCCCCTTGGAGAC -3'
(R):5'- GAGTAATCCCACATCACTGGC -3'

Sequencing Primer
(F):5'- AGACTGCACGGTGTGAACC -3'
(R):5'- GACTTTTATGCCCAAGTAAGCGAC -3'
Posted On2014-10-30