Incidental Mutation 'R2274:Vmn1r232'
ID245005
Institutional Source Beutler Lab
Gene Symbol Vmn1r232
Ensembl Gene ENSMUSG00000062165
Gene Namevomeronasal 1 receptor 232
SynonymsV1re4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R2274 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location20913205-20914363 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20914203 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 45 (L45P)
Ref Sequence ENSEMBL: ENSMUSP00000076261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077001]
Predicted Effect probably benign
Transcript: ENSMUST00000077001
AA Change: L45P

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000076261
Gene: ENSMUSG00000062165
AA Change: L45P

DomainStartEndE-ValueType
Pfam:TAS2R 46 331 6.9e-7 PFAM
Pfam:7tm_1 70 324 1e-6 PFAM
Pfam:V1R 78 338 1.9e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232004
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A T 11: 99,837,841 C59S possibly damaging Het
Abca5 A T 11: 110,275,281 N1556K possibly damaging Het
Abcb10 G T 8: 123,982,752 A21E probably benign Het
Ackr1 T C 1: 173,332,485 N156D probably benign Het
Adamtsl3 A T 7: 82,606,558 S1593C probably benign Het
Ank3 T A 10: 69,950,942 probably null Het
Aqp4 A G 18: 15,393,480 S315P probably benign Het
Atp7b T C 8: 22,020,832 I433V probably benign Het
Bco1 G A 8: 117,108,783 probably null Het
Cacna1g T A 11: 94,415,936 E1842V probably damaging Het
Calhm3 T A 19: 47,157,547 Q73L probably damaging Het
Car5a C T 8: 121,944,669 probably null Het
Cdk11b T A 4: 155,647,594 probably benign Het
Cdr2 A T 7: 120,958,509 H264Q possibly damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
D7Ertd443e A G 7: 134,270,201 S644P probably damaging Het
Dnlz A T 2: 26,351,471 C82S probably damaging Het
Egr4 A T 6: 85,512,743 F112I probably damaging Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
F11 T C 8: 45,252,147 D119G possibly damaging Het
Fat4 T A 3: 38,995,899 V3970D possibly damaging Het
Fbxw5 C A 2: 25,504,761 C222* probably null Het
Fn1 C T 1: 71,613,943 G1296R probably null Het
Ghr A G 15: 3,320,025 V557A probably benign Het
Gm11568 A G 11: 99,858,244 S92G unknown Het
Gpatch1 A T 7: 35,288,678 S678T probably benign Het
Gpr155 A G 2: 73,348,135 probably null Het
Gucy2f A T X: 142,116,273 M697K probably benign Het
Hecw1 T C 13: 14,346,068 T195A probably benign Het
Hoxd1 A G 2: 74,764,157 K252R probably damaging Het
Iqck G A 7: 118,899,657 D173N possibly damaging Het
Irf8 A G 8: 120,753,527 E168G probably damaging Het
Kcnh1 T G 1: 192,337,521 V358G probably damaging Het
Kifap3 T A 1: 163,868,758 V652D possibly damaging Het
L3hypdh T C 12: 72,084,858 Y100C possibly damaging Het
Map4k1 T A 7: 29,001,957 H729Q probably damaging Het
March1 T A 8: 66,387,499 N311K probably benign Het
Mier2 T C 10: 79,544,534 I321V probably damaging Het
Mta1 C T 12: 113,128,150 S291L probably damaging Het
Myh2 A G 11: 67,190,358 K1267E possibly damaging Het
Nbea A T 3: 55,988,085 probably null Het
Nexmif T G X: 104,087,846 E155A possibly damaging Het
Nkpd1 A G 7: 19,523,897 I534V probably benign Het
Nxph1 G T 6: 9,247,746 C239F probably damaging Het
Odc1 A G 12: 17,548,424 I189V probably benign Het
Olfr1170 A G 2: 88,224,823 F70L probably benign Het
Olfr314 T C 11: 58,786,666 V144A probably benign Het
Olfr351 A T 2: 36,860,101 N82K probably damaging Het
Olfr781 T C 10: 129,333,457 I192T probably benign Het
Pcdhb15 T C 18: 37,475,443 L576P probably damaging Het
Raph1 T C 1: 60,498,500 D499G probably damaging Het
Rptor T A 11: 119,756,322 C246* probably null Het
Rtl1 T C 12: 109,594,667 E246G unknown Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc12a3 T A 8: 94,333,287 I187N possibly damaging Het
Slc46a1 T G 11: 78,466,423 S101A probably benign Het
Slc4a8 A G 15: 100,807,402 M830V probably benign Het
Sned1 T A 1: 93,281,642 probably null Het
St3gal6 T A 16: 58,488,969 E34D possibly damaging Het
Tcstv3 C T 13: 120,317,654 Q30* probably null Het
Tex16 T A X: 112,121,141 D1112E probably damaging Het
Tmcc3 G A 10: 94,578,915 V160I probably damaging Het
Tmf1 T A 6: 97,163,586 L776F probably damaging Het
Tsr1 A T 11: 74,904,827 probably null Het
Tyrp1 A T 4: 80,837,534 E180V probably damaging Het
Ubr3 T C 2: 70,016,341 V1636A probably benign Het
Usp1 T C 4: 98,929,842 L139P probably damaging Het
Vmn1r49 G A 6: 90,072,144 T292I probably benign Het
Wdr19 T A 5: 65,240,991 M853K possibly damaging Het
Zkscan8 C T 13: 21,521,796 M265I probably benign Het
Other mutations in Vmn1r232
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Vmn1r232 APN 17 20914132 missense probably benign 0.07
IGL02576:Vmn1r232 APN 17 20913913 missense probably benign 0.30
H8562:Vmn1r232 UTSW 17 20913394 missense probably benign 0.29
R1182:Vmn1r232 UTSW 17 20913443 missense possibly damaging 0.95
R2010:Vmn1r232 UTSW 17 20913339 missense probably benign 0.00
R2088:Vmn1r232 UTSW 17 20913737 missense possibly damaging 0.63
R2206:Vmn1r232 UTSW 17 20914203 missense probably benign 0.29
R2207:Vmn1r232 UTSW 17 20914203 missense probably benign 0.29
R2273:Vmn1r232 UTSW 17 20914203 missense probably benign 0.29
R2275:Vmn1r232 UTSW 17 20914203 missense probably benign 0.29
R2443:Vmn1r232 UTSW 17 20913384 missense probably damaging 1.00
R2516:Vmn1r232 UTSW 17 20914026 missense possibly damaging 0.65
R3700:Vmn1r232 UTSW 17 20914203 missense probably benign 0.29
R5256:Vmn1r232 UTSW 17 20913584 missense probably damaging 1.00
R5418:Vmn1r232 UTSW 17 20914116 missense possibly damaging 0.75
R5726:Vmn1r232 UTSW 17 20913339 missense probably benign 0.00
R5833:Vmn1r232 UTSW 17 20913651 missense probably damaging 1.00
R6528:Vmn1r232 UTSW 17 20914047 missense probably benign 0.12
R7019:Vmn1r232 UTSW 17 20913285 missense possibly damaging 0.76
R7600:Vmn1r232 UTSW 17 20913737 missense possibly damaging 0.63
Z1088:Vmn1r232 UTSW 17 20913838 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TCAAGGAGTTAGATGTGAGCAC -3'
(R):5'- CTAACCATCGCGTTTCACAG -3'

Sequencing Primer
(F):5'- GTGAGCACATGTACTAGAATCATGTC -3'
(R):5'- CATCGCGTTTCACAGGATGG -3'
Posted On2014-10-30