Incidental Mutation 'R2292:Trak2'
ID245014
Institutional Source Beutler Lab
Gene Symbol Trak2
Ensembl Gene ENSMUSG00000026028
Gene Nametrafficking protein, kinesin binding 2
SynonymsGRIF-1, 4733401O11Rik, GRIF1, OIP98, CALS-C, 2900022D04Rik, Als2cr3
MMRRC Submission 040291-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2292 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location58900449-58973430 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58935757 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 92 (F92Y)
Ref Sequence ENSEMBL: ENSMUSP00000134253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027186] [ENSMUST00000173590] [ENSMUST00000174120]
Predicted Effect probably damaging
Transcript: ENSMUST00000027186
AA Change: F92Y

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027186
Gene: ENSMUSG00000026028
AA Change: F92Y

DomainStartEndE-ValueType
Pfam:HAP1_N 48 353 2.5e-135 PFAM
Pfam:Milton 426 565 3e-26 PFAM
low complexity region 663 673 N/A INTRINSIC
low complexity region 693 714 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173590
SMART Domains Protein: ENSMUSP00000134499
Gene: ENSMUSG00000026028

DomainStartEndE-ValueType
Pfam:HAP1_N 2 52 9.4e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174120
AA Change: F92Y

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134253
Gene: ENSMUSG00000026028
AA Change: F92Y

DomainStartEndE-ValueType
Pfam:HAP1_N 47 354 1.3e-129 PFAM
Pfam:Milton 411 565 1.1e-41 PFAM
Meta Mutation Damage Score 0.3248 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,732,139 I370T probably benign Het
A2m A G 6: 121,673,559 T1209A possibly damaging Het
Als2 T C 1: 59,187,385 Q920R probably damaging Het
Arhgap20 T A 9: 51,849,443 Y829N possibly damaging Het
Arhgap35 A T 7: 16,563,551 F530I probably damaging Het
Arid4a G T 12: 71,061,541 G40V probably damaging Het
Ascc2 T C 11: 4,679,352 probably benign Het
Cacna1b C T 2: 24,606,620 V2312I probably benign Het
Dctn6 T C 8: 34,092,525 T159A probably benign Het
Ddx55 G T 5: 124,568,077 A522S probably benign Het
Dnah6 G A 6: 73,021,109 T4110I probably damaging Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Dym A G 18: 75,199,212 T504A possibly damaging Het
E130308A19Rik T C 4: 59,690,579 Y138H probably damaging Het
Fgd4 A T 16: 16,436,000 C568S possibly damaging Het
Fkbp4 A C 6: 128,436,662 V6G probably damaging Het
Flg2 A T 3: 93,220,677 S2299C unknown Het
Gdf2 A T 14: 33,945,188 N289I possibly damaging Het
Gm13023 T C 4: 143,793,876 I66T probably benign Het
Gpr182 A G 10: 127,750,182 I300T possibly damaging Het
Iqcg A G 16: 33,049,883 V80A probably benign Het
Letm1 A AG 5: 33,769,515 probably null Het
Lyst T G 13: 13,740,495 F3258C probably damaging Het
Map3k12 T C 15: 102,500,139 E870G probably damaging Het
Mphosph10 G A 7: 64,385,771 P384L probably damaging Het
Ncoa4 T G 14: 32,173,456 L179R probably damaging Het
Nlrp1c-ps A G 11: 71,246,362 noncoding transcript Het
Nwd2 A T 5: 63,805,574 M834L probably benign Het
Olfr1361 A G 13: 21,658,831 M164T probably damaging Het
Olfr517 A T 7: 108,869,016 M46K probably benign Het
Pccb T C 9: 100,994,632 E266G probably benign Het
Pcdhb2 T A 18: 37,297,244 probably null Het
Prdm13 A C 4: 21,683,914 I119S unknown Het
Tchh A G 3: 93,442,382 Y18C probably damaging Het
Tmem192 T C 8: 64,959,346 V59A probably damaging Het
Trappc11 C T 8: 47,505,736 G40D probably damaging Het
Ttc23 A T 7: 67,669,787 I132F probably benign Het
Ttc9b A G 7: 27,655,980 D225G probably benign Het
Ubr3 G T 2: 69,897,260 probably benign Het
Vmn2r75 A C 7: 86,148,936 C556W probably damaging Het
Zbtb41 T C 1: 139,440,359 V595A probably damaging Het
Other mutations in Trak2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Trak2 APN 1 58923607 missense probably damaging 1.00
IGL01982:Trak2 APN 1 58926655 missense possibly damaging 0.94
IGL02154:Trak2 APN 1 58908729 missense probably damaging 1.00
IGL02399:Trak2 APN 1 58910045 missense probably benign 0.00
IGL02732:Trak2 APN 1 58910063 missense probably benign 0.19
IGL02734:Trak2 APN 1 58910063 missense probably benign 0.19
IGL03147:Trak2 UTSW 1 58910063 missense probably benign 0.19
P0041:Trak2 UTSW 1 58909964 missense probably damaging 1.00
R0079:Trak2 UTSW 1 58926724 missense probably damaging 1.00
R0791:Trak2 UTSW 1 58903661 missense probably benign
R0792:Trak2 UTSW 1 58903661 missense probably benign
R1099:Trak2 UTSW 1 58921841 missense probably benign 0.05
R1899:Trak2 UTSW 1 58946336 start codon destroyed probably null 0.98
R1903:Trak2 UTSW 1 58918855 splice site probably null
R2312:Trak2 UTSW 1 58935782 missense probably damaging 1.00
R3720:Trak2 UTSW 1 58946245 critical splice donor site probably null
R4966:Trak2 UTSW 1 58919321 missense probably damaging 1.00
R5088:Trak2 UTSW 1 58935808 missense probably benign 0.06
R5730:Trak2 UTSW 1 58921807 missense probably damaging 1.00
R5840:Trak2 UTSW 1 58919273 missense probably damaging 1.00
R5981:Trak2 UTSW 1 58908690 missense probably benign 0.01
R6000:Trak2 UTSW 1 58911812 missense possibly damaging 0.71
R6053:Trak2 UTSW 1 58904069 missense possibly damaging 0.62
R6894:Trak2 UTSW 1 58911733 missense probably damaging 1.00
R6916:Trak2 UTSW 1 58910025 missense probably benign 0.06
R7096:Trak2 UTSW 1 58903590 missense probably damaging 1.00
R7544:Trak2 UTSW 1 58921068 splice site probably null
R7847:Trak2 UTSW 1 58935818 missense possibly damaging 0.88
R7889:Trak2 UTSW 1 58918824 missense probably damaging 1.00
R8039:Trak2 UTSW 1 58946288 missense probably benign 0.16
R8313:Trak2 UTSW 1 58921147 nonsense probably null
X0067:Trak2 UTSW 1 58908532 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- TTTCTCAGTCATAAGCATGGCAAC -3'
(R):5'- CTTAGATGTCTGCTCCAACGAGG -3'

Sequencing Primer
(F):5'- GGGTCGCTCAAACATAACAGCTG -3'
(R):5'- AGGATCTCCCTGAAGTCGAG -3'
Posted On2014-10-30