Incidental Mutation 'R2292:Als2'
ID245015
Institutional Source Beutler Lab
Gene Symbol Als2
Ensembl Gene ENSMUSG00000026024
Gene Namealsin Rho guanine nucleotide exchange factor
Synonyms3222402C23Rik, Als2cr6, 9430073A21Rik, Alsin
MMRRC Submission 040291-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.662) question?
Stock #R2292 (G1)
Quality Score203
Status Validated
Chromosome1
Chromosomal Location59162926-59237231 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59187385 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 920 (Q920R)
Ref Sequence ENSEMBL: ENSMUSP00000125753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027178] [ENSMUST00000163058]
Predicted Effect probably damaging
Transcript: ENSMUST00000027178
AA Change: Q920R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027178
Gene: ENSMUSG00000026024
AA Change: Q920R

DomainStartEndE-ValueType
Pfam:RCC1_2 93 122 1.1e-9 PFAM
Pfam:RCC1 109 165 9.5e-11 PFAM
Pfam:RCC1 170 216 6.6e-11 PFAM
low complexity region 268 282 N/A INTRINSIC
low complexity region 465 483 N/A INTRINSIC
Pfam:RCC1 521 568 5.4e-13 PFAM
Pfam:RCC1_2 555 584 8.3e-12 PFAM
Pfam:RCC1 571 619 3.4e-11 PFAM
Pfam:RhoGEF 688 877 6.5e-10 PFAM
PH 895 1001 2.17e0 SMART
MORN 1041 1062 1.34e-5 SMART
MORN 1064 1085 1.95e-1 SMART
MORN 1092 1113 6.68e-6 SMART
MORN 1115 1136 9.39e0 SMART
MORN 1143 1164 1.49e1 SMART
MORN 1167 1188 1.13e1 SMART
MORN 1190 1211 2.28e0 SMART
MORN 1213 1235 5.95e1 SMART
low complexity region 1470 1483 N/A INTRINSIC
Pfam:VPS9 1546 1650 8.6e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159166
Predicted Effect probably damaging
Transcript: ENSMUST00000163058
AA Change: Q920R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125753
Gene: ENSMUSG00000026024
AA Change: Q920R

DomainStartEndE-ValueType
Pfam:RCC1_2 93 122 9.9e-10 PFAM
Pfam:RCC1 109 165 9.5e-12 PFAM
Pfam:RCC1 170 216 4.9e-12 PFAM
low complexity region 268 282 N/A INTRINSIC
low complexity region 465 483 N/A INTRINSIC
Pfam:RCC1 521 568 4.6e-14 PFAM
Pfam:RCC1_2 555 584 1.2e-11 PFAM
Pfam:RCC1 571 619 8.6e-11 PFAM
Pfam:RhoGEF 688 877 2.6e-10 PFAM
PH 895 1001 2.17e0 SMART
MORN 1041 1062 1.34e-5 SMART
MORN 1064 1085 1.95e-1 SMART
MORN 1092 1113 6.68e-6 SMART
MORN 1115 1136 9.39e0 SMART
MORN 1143 1164 1.49e1 SMART
MORN 1167 1188 1.13e1 SMART
MORN 1190 1211 2.28e0 SMART
MORN 1213 1235 5.95e1 SMART
low complexity region 1470 1483 N/A INTRINSIC
Pfam:VPS9 1546 1650 1e-24 PFAM
Meta Mutation Damage Score 0.1592 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains an ATS1/RCC1-like domain, a RhoGEF domain, and a vacuolar protein sorting 9 (VPS9) domain, all of which are guanine-nucleotide exchange factors that activate members of the Ras superfamily of GTPases. The protein functions as a guanine nucleotide exchange factor for the small GTPase RAB5. The protein localizes with RAB5 on early endosomal compartments, and functions as a modulator for endosomal dynamics. Mutations in this gene result in several forms of juvenile lateral sclerosis and infantile-onset ascending spastic paralysis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null mutations in this gene may result in increased body weight, altered endosome trafficking, modest motor behavioral abnormalities, altered anxiety responses, impaired axonal transport, and mild neurolopathogical deficits including axonal degeneration in the corticospinal tract. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,732,139 I370T probably benign Het
A2m A G 6: 121,673,559 T1209A possibly damaging Het
Arhgap20 T A 9: 51,849,443 Y829N possibly damaging Het
Arhgap35 A T 7: 16,563,551 F530I probably damaging Het
Arid4a G T 12: 71,061,541 G40V probably damaging Het
Ascc2 T C 11: 4,679,352 probably benign Het
Cacna1b C T 2: 24,606,620 V2312I probably benign Het
Dctn6 T C 8: 34,092,525 T159A probably benign Het
Ddx55 G T 5: 124,568,077 A522S probably benign Het
Dnah6 G A 6: 73,021,109 T4110I probably damaging Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Dym A G 18: 75,199,212 T504A possibly damaging Het
E130308A19Rik T C 4: 59,690,579 Y138H probably damaging Het
Fgd4 A T 16: 16,436,000 C568S possibly damaging Het
Fkbp4 A C 6: 128,436,662 V6G probably damaging Het
Flg2 A T 3: 93,220,677 S2299C unknown Het
Gdf2 A T 14: 33,945,188 N289I possibly damaging Het
Gm13023 T C 4: 143,793,876 I66T probably benign Het
Gpr182 A G 10: 127,750,182 I300T possibly damaging Het
Iqcg A G 16: 33,049,883 V80A probably benign Het
Letm1 A AG 5: 33,769,515 probably null Het
Lyst T G 13: 13,740,495 F3258C probably damaging Het
Map3k12 T C 15: 102,500,139 E870G probably damaging Het
Mphosph10 G A 7: 64,385,771 P384L probably damaging Het
Ncoa4 T G 14: 32,173,456 L179R probably damaging Het
Nlrp1c-ps A G 11: 71,246,362 noncoding transcript Het
Nwd2 A T 5: 63,805,574 M834L probably benign Het
Olfr1361 A G 13: 21,658,831 M164T probably damaging Het
Olfr517 A T 7: 108,869,016 M46K probably benign Het
Pccb T C 9: 100,994,632 E266G probably benign Het
Pcdhb2 T A 18: 37,297,244 probably null Het
Prdm13 A C 4: 21,683,914 I119S unknown Het
Tchh A G 3: 93,442,382 Y18C probably damaging Het
Tmem192 T C 8: 64,959,346 V59A probably damaging Het
Trak2 A T 1: 58,935,757 F92Y probably damaging Het
Trappc11 C T 8: 47,505,736 G40D probably damaging Het
Ttc23 A T 7: 67,669,787 I132F probably benign Het
Ttc9b A G 7: 27,655,980 D225G probably benign Het
Ubr3 G T 2: 69,897,260 probably benign Het
Vmn2r75 A C 7: 86,148,936 C556W probably damaging Het
Zbtb41 T C 1: 139,440,359 V595A probably damaging Het
Other mutations in Als2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Als2 APN 1 59169896 nonsense probably null
IGL00924:Als2 APN 1 59215862 missense probably benign 0.03
IGL00949:Als2 APN 1 59215572 missense probably damaging 1.00
IGL00950:Als2 APN 1 59215382 missense probably benign 0.01
IGL01090:Als2 APN 1 59215616 missense possibly damaging 0.81
IGL01116:Als2 APN 1 59186004 splice site probably benign
IGL02001:Als2 APN 1 59180188 splice site probably benign
IGL02075:Als2 APN 1 59207786 missense probably damaging 1.00
IGL02441:Als2 APN 1 59215472 missense probably damaging 0.98
IGL02728:Als2 APN 1 59196347 missense probably benign 0.00
IGL02740:Als2 APN 1 59169919 missense probably benign 0.01
IGL02885:Als2 APN 1 59167491 missense probably benign 0.30
IGL02896:Als2 APN 1 59183787 missense probably benign 0.17
IGL02978:Als2 APN 1 59215165 missense probably benign 0.32
IGL03032:Als2 APN 1 59216030 splice site probably benign
IGL03065:Als2 APN 1 59215872 missense probably benign
IGL03212:Als2 APN 1 59202926 missense probably benign 0.00
IGL03226:Als2 APN 1 59186520 missense probably benign 0.43
R0014:Als2 UTSW 1 59211388 missense possibly damaging 0.53
R0243:Als2 UTSW 1 59215387 missense probably benign
R0326:Als2 UTSW 1 59180583 missense probably damaging 1.00
R0376:Als2 UTSW 1 59215565 missense probably benign 0.00
R0605:Als2 UTSW 1 59168414 missense probably benign 0.02
R1607:Als2 UTSW 1 59180147 missense probably damaging 1.00
R1631:Als2 UTSW 1 59218067 missense probably benign 0.00
R1657:Als2 UTSW 1 59180601 missense probably damaging 1.00
R1763:Als2 UTSW 1 59174991 missense probably benign
R1950:Als2 UTSW 1 59185601 critical splice acceptor site probably null
R1970:Als2 UTSW 1 59215169 missense probably benign 0.34
R2151:Als2 UTSW 1 59207789 missense probably damaging 1.00
R2513:Als2 UTSW 1 59215117 missense probably benign 0.00
R2849:Als2 UTSW 1 59206538 missense probably damaging 0.97
R2869:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2869:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2870:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2870:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2872:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2872:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2873:Als2 UTSW 1 59211137 missense probably damaging 1.00
R3054:Als2 UTSW 1 59215494 missense probably damaging 1.00
R3081:Als2 UTSW 1 59187349 missense probably damaging 1.00
R3176:Als2 UTSW 1 59170008 missense possibly damaging 0.88
R3276:Als2 UTSW 1 59170008 missense possibly damaging 0.88
R3801:Als2 UTSW 1 59167199 missense probably damaging 1.00
R3803:Als2 UTSW 1 59167199 missense probably damaging 1.00
R3808:Als2 UTSW 1 59170450 missense probably benign 0.08
R3884:Als2 UTSW 1 59185568 missense probably damaging 0.99
R4012:Als2 UTSW 1 59187416 missense probably benign 0.09
R4033:Als2 UTSW 1 59196241 missense probably benign
R4201:Als2 UTSW 1 59180154 missense possibly damaging 0.77
R4321:Als2 UTSW 1 59167454 splice site probably benign
R4707:Als2 UTSW 1 59215313 missense probably benign
R4784:Als2 UTSW 1 59215313 missense probably benign
R4785:Als2 UTSW 1 59215313 missense probably benign
R4991:Als2 UTSW 1 59207768 missense probably benign 0.10
R5068:Als2 UTSW 1 59211274 missense probably benign 0.13
R5110:Als2 UTSW 1 59185441 missense probably damaging 0.98
R5141:Als2 UTSW 1 59170452 missense possibly damaging 0.80
R5394:Als2 UTSW 1 59174946 missense probably benign 0.06
R5621:Als2 UTSW 1 59191890 missense probably benign 0.33
R5685:Als2 UTSW 1 59179091 missense possibly damaging 0.73
R5987:Als2 UTSW 1 59206587 missense probably damaging 1.00
R6012:Als2 UTSW 1 59185215 missense probably damaging 1.00
R6118:Als2 UTSW 1 59203069 missense possibly damaging 0.62
R6222:Als2 UTSW 1 59180125 missense probably benign 0.04
R6367:Als2 UTSW 1 59199140 missense probably benign 0.04
R6394:Als2 UTSW 1 59167197 missense probably damaging 0.99
R6866:Als2 UTSW 1 59211133 missense probably damaging 1.00
R6965:Als2 UTSW 1 59170557 missense possibly damaging 0.70
R7038:Als2 UTSW 1 59167514 missense possibly damaging 0.94
R7178:Als2 UTSW 1 59207812 missense probably damaging 0.96
R7494:Als2 UTSW 1 59183166 splice site probably null
R7541:Als2 UTSW 1 59167616 splice site probably null
R7601:Als2 UTSW 1 59170002 missense probably benign 0.17
R8380:Als2 UTSW 1 59211308 missense probably benign
Predicted Primers PCR Primer
(F):5'- TATGAGTACACTGACATTCGTGTAG -3'
(R):5'- AGCCTTTGCCCTTAGGTTTG -3'

Sequencing Primer
(F):5'- ACACTGACATTCGTGTAGCAGTG -3'
(R):5'- GCCCTTAGGTTTGCTTGCTACTG -3'
Posted On2014-10-30