Incidental Mutation 'R0278:Adgre1'
Institutional Source Beutler Lab
Gene Symbol Adgre1
Ensembl Gene ENSMUSG00000004730
Gene Nameadhesion G protein-coupled receptor E1
SynonymsEmr1, EGF-TM7, F4/80, DD7A5-7, TM7LN3, Ly71
MMRRC Submission 038500-MU
Accession Numbers

Ncbi RefSeq: NM_010130.4 ;MGI:106912

Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R0278 (G1)
Quality Score225
Status Not validated
Chromosomal Location57358686-57483529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57447872 bp
Amino Acid Change Isoleucine to Valine at position 657 (I657V)
Ref Sequence ENSEMBL: ENSMUSP00000083971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004850] [ENSMUST00000086763]
Predicted Effect probably benign
Transcript: ENSMUST00000004850
AA Change: I657V

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000004850
Gene: ENSMUSG00000004730
AA Change: I657V

low complexity region 19 32 N/A INTRINSIC
EGF 35 80 1.43e-1 SMART
EGF_CA 81 122 3.59e-7 SMART
EGF_CA 133 172 4.56e-9 SMART
EGF_CA 173 221 1.29e-8 SMART
EGF_CA 222 271 2.31e-10 SMART
EGF_CA 272 318 1.06e-9 SMART
EGF_CA 319 367 1.18e-7 SMART
GPS 591 641 2.57e-19 SMART
Pfam:7tm_2 644 885 2.1e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086763
AA Change: I657V

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000083971
Gene: ENSMUSG00000004730
AA Change: I657V

low complexity region 19 32 N/A INTRINSIC
EGF 35 80 1.43e-1 SMART
EGF_CA 81 122 3.59e-7 SMART
EGF_CA 133 172 4.56e-9 SMART
EGF_CA 173 221 1.29e-8 SMART
EGF_CA 222 271 2.31e-10 SMART
EGF_CA 272 318 1.06e-9 SMART
EGF_CA 319 367 1.18e-7 SMART
GPS 591 641 2.57e-19 SMART
Pfam:7tm_2 644 885 2.1e-63 PFAM
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.4%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype Strain: 3582333
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has a domain resembling seven transmembrane G protein-coupled hormone receptors (7TM receptors) at its C-terminus. The N-terminus of the encoded protein has six EGF-like modules, separated from the transmembrane segments by a serine/threonine-rich domain, a feature reminiscent of mucin-like, single-span, integral membrane glycoproteins with adhesive properties. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice fail to develop peripheral tolerance after inoculation with antigen because of a lack of efferent regulatory T cell development. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Chemically induced(1)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,378,215 S3429R probably damaging Het
Abca3 A G 17: 24,381,920 D436G probably benign Het
Acacb C A 5: 114,233,259 Y1816* probably null Het
Acer3 T C 7: 98,261,597 Y86C probably damaging Het
Akap1 A G 11: 88,845,194 V214A probably benign Het
Ankrd42 T C 7: 92,631,657 R22G possibly damaging Het
Apc2 C T 10: 80,312,813 P1234S possibly damaging Het
Atp13a4 A G 16: 29,454,834 I441T probably damaging Het
Cenpu G A 8: 46,578,309 A242T probably damaging Het
Col6a6 A T 9: 105,767,288 V1267E possibly damaging Het
Crhr2 T C 6: 55,117,531 T58A probably benign Het
Ddx6 T G 9: 44,631,425 C385G probably damaging Het
Dnah7a A T 1: 53,504,146 N2288K probably benign Het
Egfl8 A T 17: 34,614,368 probably null Het
Elmo2 A T 2: 165,297,367 I420N probably damaging Het
Elovl4 A G 9: 83,783,195 F113L probably benign Het
Fancd2 T A 6: 113,548,448 probably null Het
Fbxl13 A G 5: 21,523,910 V456A probably benign Het
Fgfr2 A T 7: 130,261,862 probably null Het
Fkbpl A T 17: 34,645,410 R51* probably null Het
Fn3krp G A 11: 121,421,580 V40M probably damaging Het
Fnip1 A G 11: 54,489,343 probably null Het
Gm15446 A T 5: 109,943,415 Q511L probably benign Het
Gm7334 A G 17: 50,699,261 K192E probably damaging Het
H2-Q10 A T 17: 35,473,307 T282S possibly damaging Het
Hspa9 A G 18: 34,940,910 V482A possibly damaging Het
Ica1l A T 1: 60,013,996 S128T probably benign Het
Il7r A T 15: 9,516,337 I126K probably damaging Het
Kcnj8 T C 6: 142,570,348 E11G probably benign Het
Klkb1 A C 8: 45,272,409 F498V probably benign Het
Lama1 A G 17: 67,810,183 E2491G probably null Het
Lhfpl2 T C 13: 94,174,435 V71A probably benign Het
Lin9 T C 1: 180,665,923 I198T probably damaging Het
Lrrc7 T A 3: 158,179,795 M431L possibly damaging Het
Nmt2 A G 2: 3,325,387 T519A probably benign Het
Olfr1043 A T 2: 86,162,579 Y123* probably null Het
Olfr1247 A T 2: 89,609,763 L113Q probably damaging Het
Olfr1247 G T 2: 89,609,764 L113M probably damaging Het
Olfr1490 C A 19: 13,654,764 L112I probably damaging Het
Olfr1490 T A 19: 13,654,765 L112H probably damaging Het
Olfr412 T C 11: 74,365,202 F178L probably damaging Het
Olfr871 G T 9: 20,212,886 C179F probably damaging Het
Parp4 A G 14: 56,607,523 R624G probably damaging Het
Pex16 C T 2: 92,381,056 P325S probably damaging Het
Pik3ca T C 3: 32,439,753 M288T possibly damaging Het
Pla2g5 C T 4: 138,800,656 D100N probably benign Het
Prss43 T A 9: 110,827,362 M39K probably benign Het
Psd4 T C 2: 24,394,438 S105P probably damaging Het
Ptprz1 T A 6: 23,000,817 S969T probably benign Het
Rad23b T A 4: 55,383,575 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rpl10l A G 12: 66,284,356 M1T probably null Het
Sec16a A G 2: 26,428,316 S1588P probably damaging Het
Sh3rf1 A T 8: 61,374,018 H602L probably damaging Het
Sparcl1 A T 5: 104,088,397 S497T probably benign Het
Spata13 A G 14: 60,692,088 Y365C probably benign Het
Trim5 T C 7: 104,279,675 N20D probably benign Het
Vmn1r201 G T 13: 22,475,024 W136L probably damaging Het
Vmn2r112 A G 17: 22,603,006 I222V probably benign Het
Vmn2r56 A T 7: 12,715,717 V198D probably damaging Het
Wapl A G 14: 34,692,612 D477G possibly damaging Het
Zfp202 C A 9: 40,208,482 H194N probably benign Het
Zfp212 C T 6: 47,926,519 R13W probably damaging Het
Other mutations in Adgre1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Adgre1 APN 17 57450055 missense probably benign 0.00
IGL00966:Adgre1 APN 17 57419335 missense probably benign 0.04
IGL01680:Adgre1 APN 17 57402620 missense unknown
IGL01724:Adgre1 APN 17 57444064 nonsense probably null
IGL02172:Adgre1 APN 17 57478879 missense probably damaging 1.00
IGL02260:Adgre1 APN 17 57447891 missense probably benign 0.01
IGL02272:Adgre1 APN 17 57450021 nonsense probably null
IGL02336:Adgre1 APN 17 57411024 nonsense probably null
IGL02346:Adgre1 APN 17 57443919 missense probably benign 0.15
IGL02398:Adgre1 APN 17 57402824 nonsense probably null
IGL02618:Adgre1 APN 17 57444021 missense possibly damaging 0.66
IGL02690:Adgre1 APN 17 57480921 missense probably damaging 1.00
IGL02936:Adgre1 APN 17 57478833 missense probably benign 0.26
IGL03112:Adgre1 APN 17 57448029 splice site probably null
IGL03350:Adgre1 APN 17 57401908 missense probably benign 0.16
F480 UTSW 17 57444063 missense probably damaging 1.00
lomax UTSW 17 57402811 missense unknown
Onion UTSW 17 57402841 nonsense probably null
Scallion UTSW 17 57401977 missense possibly damaging 0.90
R0049:Adgre1 UTSW 17 57402841 nonsense probably null
R0153:Adgre1 UTSW 17 57443939 missense possibly damaging 0.92
R0277:Adgre1 UTSW 17 57444060 missense probably benign 0.00
R0323:Adgre1 UTSW 17 57444060 missense probably benign 0.00
R0389:Adgre1 UTSW 17 57406839 missense possibly damaging 0.80
R0492:Adgre1 UTSW 17 57402742 missense unknown
R0621:Adgre1 UTSW 17 57441359 missense probably damaging 0.98
R0647:Adgre1 UTSW 17 57411003 missense probably damaging 1.00
R1310:Adgre1 UTSW 17 57447936 missense probably benign 0.00
R1601:Adgre1 UTSW 17 57441353 missense probably benign 0.01
R1689:Adgre1 UTSW 17 57449921 missense probably benign 0.31
R1708:Adgre1 UTSW 17 57401974 missense possibly damaging 0.93
R1796:Adgre1 UTSW 17 57441350 missense probably benign 0.43
R1839:Adgre1 UTSW 17 57441299 missense probably benign 0.00
R1860:Adgre1 UTSW 17 57441363 missense probably benign 0.00
R2165:Adgre1 UTSW 17 57419338 missense probably damaging 0.97
R2219:Adgre1 UTSW 17 57401912 missense possibly damaging 0.92
R2519:Adgre1 UTSW 17 57410956 missense probably damaging 1.00
R3874:Adgre1 UTSW 17 57401925 missense probably benign 0.08
R3911:Adgre1 UTSW 17 57447860 missense probably damaging 1.00
R4190:Adgre1 UTSW 17 57402811 missense unknown
R4439:Adgre1 UTSW 17 57447954 missense probably damaging 1.00
R4513:Adgre1 UTSW 17 57410947 missense probably benign 0.34
R4529:Adgre1 UTSW 17 57420519 missense possibly damaging 0.92
R4543:Adgre1 UTSW 17 57406874 missense probably benign 0.07
R4610:Adgre1 UTSW 17 57450073 missense possibly damaging 0.50
R4665:Adgre1 UTSW 17 57480947 missense probably benign 0.20
R4911:Adgre1 UTSW 17 57447832 missense possibly damaging 0.57
R4928:Adgre1 UTSW 17 57444064 nonsense probably null
R4942:Adgre1 UTSW 17 57406903 missense probably damaging 1.00
R4946:Adgre1 UTSW 17 57443918 missense probably benign 0.33
R4953:Adgre1 UTSW 17 57441321 missense probably damaging 0.99
R5107:Adgre1 UTSW 17 57401977 missense possibly damaging 0.90
R5366:Adgre1 UTSW 17 57402817 missense probably benign 0.39
R5590:Adgre1 UTSW 17 57445034 missense probably damaging 1.00
R5619:Adgre1 UTSW 17 57420437 missense probably benign 0.15
R5699:Adgre1 UTSW 17 57481007 missense probably benign 0.43
R5734:Adgre1 UTSW 17 57443990 missense probably benign 0.00
R5860:Adgre1 UTSW 17 57445034 missense probably damaging 1.00
R6039:Adgre1 UTSW 17 57406859 missense probably benign 0.28
R6039:Adgre1 UTSW 17 57406859 missense probably benign 0.28
R6149:Adgre1 UTSW 17 57445018 missense probably benign 0.08
R6478:Adgre1 UTSW 17 57401955 missense possibly damaging 0.81
R6709:Adgre1 UTSW 17 57406917 missense probably benign 0.10
R6864:Adgre1 UTSW 17 57478879 missense probably damaging 1.00
R6945:Adgre1 UTSW 17 57410844 missense probably benign 0.01
R6945:Adgre1 UTSW 17 57420399 missense probably benign 0.39
R6988:Adgre1 UTSW 17 57408445 missense probably benign 0.00
R7019:Adgre1 UTSW 17 57410945 missense probably damaging 0.98
R7154:Adgre1 UTSW 17 57444087 splice site probably null
R7347:Adgre1 UTSW 17 57420441 missense probably damaging 1.00
R7459:Adgre1 UTSW 17 57449933 missense probably damaging 1.00
R7709:Adgre1 UTSW 17 57402519 missense unknown
R8187:Adgre1 UTSW 17 57420349 missense probably benign 0.00
R8210:Adgre1 UTSW 17 57445061 missense possibly damaging 0.94
R8223:Adgre1 UTSW 17 57361692 missense probably damaging 0.99
Z1176:Adgre1 UTSW 17 57361729 missense possibly damaging 0.76
Z1177:Adgre1 UTSW 17 57419374 missense probably damaging 0.96
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- agtttcctttttttctgccttcc -3'
Posted On2013-04-16