Incidental Mutation 'R2292:Prdm13'
ID245022
Institutional Source Beutler Lab
Gene Symbol Prdm13
Ensembl Gene ENSMUSG00000040478
Gene NamePR domain containing 13
Synonyms
MMRRC Submission 040291-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2292 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location21677480-21685963 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 21683914 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 119 (I119S)
Ref Sequence ENSEMBL: ENSMUSP00000092761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076206] [ENSMUST00000095141]
Predicted Effect unknown
Transcript: ENSMUST00000076206
AA Change: I71S
SMART Domains Protein: ENSMUSP00000075562
Gene: ENSMUSG00000040478
AA Change: I71S

DomainStartEndE-ValueType
Blast:SET 2 118 4e-72 BLAST
PDB:3EP0|B 56 132 1e-8 PDB
ZnF_C2H2 137 159 3.34e-2 SMART
low complexity region 204 220 N/A INTRINSIC
low complexity region 231 252 N/A INTRINSIC
low complexity region 267 275 N/A INTRINSIC
low complexity region 302 335 N/A INTRINSIC
low complexity region 336 350 N/A INTRINSIC
low complexity region 353 370 N/A INTRINSIC
low complexity region 392 404 N/A INTRINSIC
low complexity region 546 571 N/A INTRINSIC
ZnF_C2H2 572 594 4.4e-2 SMART
ZnF_C2H2 600 622 1.92e-2 SMART
ZnF_C2H2 629 652 2.79e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000095141
AA Change: I119S
SMART Domains Protein: ENSMUSP00000092761
Gene: ENSMUSG00000040478
AA Change: I119S

DomainStartEndE-ValueType
Blast:SET 42 166 1e-73 BLAST
PDB:3EP0|B 104 180 1e-8 PDB
ZnF_C2H2 185 207 3.34e-2 SMART
low complexity region 252 268 N/A INTRINSIC
low complexity region 279 300 N/A INTRINSIC
low complexity region 315 323 N/A INTRINSIC
low complexity region 350 383 N/A INTRINSIC
low complexity region 384 398 N/A INTRINSIC
low complexity region 401 418 N/A INTRINSIC
low complexity region 440 452 N/A INTRINSIC
low complexity region 594 619 N/A INTRINSIC
ZnF_C2H2 620 642 4.4e-2 SMART
ZnF_C2H2 648 670 1.92e-2 SMART
ZnF_C2H2 677 700 2.79e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144160
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149516
Meta Mutation Damage Score 0.3575 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 100% (44/44)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show a specific reduction in the number of GABAergic and glycinergic amacrine cells, a thin retinal inner nuclear layer, altered retinal inner plexiform layer morphology, and abnormally increased spatial, temporal, and contrast sensitivities in optokinetic reponses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,732,139 I370T probably benign Het
A2m A G 6: 121,673,559 T1209A possibly damaging Het
Als2 T C 1: 59,187,385 Q920R probably damaging Het
Arhgap20 T A 9: 51,849,443 Y829N possibly damaging Het
Arhgap35 A T 7: 16,563,551 F530I probably damaging Het
Arid4a G T 12: 71,061,541 G40V probably damaging Het
Ascc2 T C 11: 4,679,352 probably benign Het
Cacna1b C T 2: 24,606,620 V2312I probably benign Het
Dctn6 T C 8: 34,092,525 T159A probably benign Het
Ddx55 G T 5: 124,568,077 A522S probably benign Het
Dnah6 G A 6: 73,021,109 T4110I probably damaging Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Dym A G 18: 75,199,212 T504A possibly damaging Het
E130308A19Rik T C 4: 59,690,579 Y138H probably damaging Het
Fgd4 A T 16: 16,436,000 C568S possibly damaging Het
Fkbp4 A C 6: 128,436,662 V6G probably damaging Het
Flg2 A T 3: 93,220,677 S2299C unknown Het
Gdf2 A T 14: 33,945,188 N289I possibly damaging Het
Gm13023 T C 4: 143,793,876 I66T probably benign Het
Gpr182 A G 10: 127,750,182 I300T possibly damaging Het
Iqcg A G 16: 33,049,883 V80A probably benign Het
Letm1 A AG 5: 33,769,515 probably null Het
Lyst T G 13: 13,740,495 F3258C probably damaging Het
Map3k12 T C 15: 102,500,139 E870G probably damaging Het
Mphosph10 G A 7: 64,385,771 P384L probably damaging Het
Ncoa4 T G 14: 32,173,456 L179R probably damaging Het
Nlrp1c-ps A G 11: 71,246,362 noncoding transcript Het
Nwd2 A T 5: 63,805,574 M834L probably benign Het
Olfr1361 A G 13: 21,658,831 M164T probably damaging Het
Olfr517 A T 7: 108,869,016 M46K probably benign Het
Pccb T C 9: 100,994,632 E266G probably benign Het
Pcdhb2 T A 18: 37,297,244 probably null Het
Tchh A G 3: 93,442,382 Y18C probably damaging Het
Tmem192 T C 8: 64,959,346 V59A probably damaging Het
Trak2 A T 1: 58,935,757 F92Y probably damaging Het
Trappc11 C T 8: 47,505,736 G40D probably damaging Het
Ttc23 A T 7: 67,669,787 I132F probably benign Het
Ttc9b A G 7: 27,655,980 D225G probably benign Het
Ubr3 G T 2: 69,897,260 probably benign Het
Vmn2r75 A C 7: 86,148,936 C556W probably damaging Het
Zbtb41 T C 1: 139,440,359 V595A probably damaging Het
Other mutations in Prdm13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02940:Prdm13 APN 4 21683421 nonsense probably null
IGL03211:Prdm13 APN 4 21678492 missense probably damaging 1.00
R0363:Prdm13 UTSW 4 21679737 missense unknown
R0512:Prdm13 UTSW 4 21678490 missense probably damaging 1.00
R0726:Prdm13 UTSW 4 21683914 missense unknown
R1056:Prdm13 UTSW 4 21678544 missense probably damaging 1.00
R1433:Prdm13 UTSW 4 21678909 missense probably damaging 1.00
R2005:Prdm13 UTSW 4 21685695 utr 5 prime probably benign
R2382:Prdm13 UTSW 4 21678277 missense possibly damaging 0.73
R3620:Prdm13 UTSW 4 21683532 missense unknown
R4039:Prdm13 UTSW 4 21685774 utr 5 prime probably benign
R4417:Prdm13 UTSW 4 21678756 missense probably benign 0.39
R4453:Prdm13 UTSW 4 21679464 missense unknown
R4850:Prdm13 UTSW 4 21678243 missense possibly damaging 0.92
R4864:Prdm13 UTSW 4 21685543 missense unknown
R4934:Prdm13 UTSW 4 21678223 utr 3 prime probably benign
R5138:Prdm13 UTSW 4 21679507 missense unknown
R5304:Prdm13 UTSW 4 21678984 missense probably damaging 1.00
R5394:Prdm13 UTSW 4 21679455 missense unknown
R5909:Prdm13 UTSW 4 21683894 missense unknown
R5964:Prdm13 UTSW 4 21683852 nonsense probably null
R6261:Prdm13 UTSW 4 21678366 missense probably damaging 1.00
R7166:Prdm13 UTSW 4 21683528 missense unknown
R7175:Prdm13 UTSW 4 21679473 missense unknown
R7549:Prdm13 UTSW 4 21679072 missense probably damaging 1.00
R7966:Prdm13 UTSW 4 21679932 missense unknown
R8319:Prdm13 UTSW 4 21679327 missense unknown
R8326:Prdm13 UTSW 4 21679557 missense unknown
Z1176:Prdm13 UTSW 4 21679518 missense unknown
Z1177:Prdm13 UTSW 4 21679623 missense unknown
Predicted Primers PCR Primer
(F):5'- ATGTTGAGGAGAGAATTCTTGCC -3'
(R):5'- TTTCCACTCTCTAAGCTGGGG -3'

Sequencing Primer
(F):5'- GAGGAGAGAATTCTTGCCTTTCAAAG -3'
(R):5'- GGGTCAAAGAGAACACATCTGCTTTC -3'
Posted On2014-10-30