Incidental Mutation 'R2292:Dvl1'
ID245025
Institutional Source Beutler Lab
Gene Symbol Dvl1
Ensembl Gene ENSMUSG00000029071
Gene Namedishevelled segment polarity protein 1
Synonyms
MMRRC Submission 040291-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2292 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location155847402-155859303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 155847816 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 28 (V28I)
Ref Sequence ENSEMBL: ENSMUSP00000133137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030947] [ENSMUST00000030948] [ENSMUST00000168552]
Predicted Effect probably benign
Transcript: ENSMUST00000030947
SMART Domains Protein: ENSMUSP00000030947
Gene: ENSMUSG00000029070

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 38 156 6.16e-4 SMART
IG 170 291 9.71e-2 SMART
transmembrane domain 340 362 N/A INTRINSIC
low complexity region 371 384 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000030948
AA Change: V28I

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030948
Gene: ENSMUSG00000029071
AA Change: V28I

DomainStartEndE-ValueType
DAX 1 85 2.17e-52 SMART
Pfam:Dishevelled 144 215 1.1e-31 PFAM
low complexity region 217 233 N/A INTRINSIC
low complexity region 235 246 N/A INTRINSIC
PDZ 260 339 3.13e-16 SMART
low complexity region 380 397 N/A INTRINSIC
DEP 425 499 1.47e-26 SMART
Pfam:Dsh_C 503 685 4.2e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126487
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132142
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141766
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143457
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156997
Predicted Effect possibly damaging
Transcript: ENSMUST00000168552
AA Change: V28I

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133137
Gene: ENSMUSG00000029071
AA Change: V28I

DomainStartEndE-ValueType
DAX 1 85 2.17e-52 SMART
Pfam:Dishevelled 90 247 1.7e-60 PFAM
PDZ 260 339 3.13e-16 SMART
low complexity region 380 397 N/A INTRINSIC
DEP 425 499 1.47e-26 SMART
Pfam:Dsh_C 503 685 7.6e-59 PFAM
Meta Mutation Damage Score 0.0748 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the Dishevelled family of proteins. These proteins have an N-terminal Dishevelled/Axin domain, a Dishevelled, EGL-10, Plextrin domain, a central PDZ domain, and a C-terminal domain of approximately 200 amino acids. They regulate both canonical and non-canonical Wnt signaling as well as planar cell polarity pathways. Mice deficient for this gene are viable and fertile but display reduced social interaction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygous targeted mutants are viable and fertile, but show a number of behavioral changes including deficient nest-building, less huddling contact during sleep, reduced subordinate responses, and other social interaction deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,732,139 I370T probably benign Het
A2m A G 6: 121,673,559 T1209A possibly damaging Het
Als2 T C 1: 59,187,385 Q920R probably damaging Het
Arhgap20 T A 9: 51,849,443 Y829N possibly damaging Het
Arhgap35 A T 7: 16,563,551 F530I probably damaging Het
Arid4a G T 12: 71,061,541 G40V probably damaging Het
Ascc2 T C 11: 4,679,352 probably benign Het
Cacna1b C T 2: 24,606,620 V2312I probably benign Het
Dctn6 T C 8: 34,092,525 T159A probably benign Het
Ddx55 G T 5: 124,568,077 A522S probably benign Het
Dnah6 G A 6: 73,021,109 T4110I probably damaging Het
Dym A G 18: 75,199,212 T504A possibly damaging Het
E130308A19Rik T C 4: 59,690,579 Y138H probably damaging Het
Fgd4 A T 16: 16,436,000 C568S possibly damaging Het
Fkbp4 A C 6: 128,436,662 V6G probably damaging Het
Flg2 A T 3: 93,220,677 S2299C unknown Het
Gdf2 A T 14: 33,945,188 N289I possibly damaging Het
Gm13023 T C 4: 143,793,876 I66T probably benign Het
Gpr182 A G 10: 127,750,182 I300T possibly damaging Het
Iqcg A G 16: 33,049,883 V80A probably benign Het
Letm1 A AG 5: 33,769,515 probably null Het
Lyst T G 13: 13,740,495 F3258C probably damaging Het
Map3k12 T C 15: 102,500,139 E870G probably damaging Het
Mphosph10 G A 7: 64,385,771 P384L probably damaging Het
Ncoa4 T G 14: 32,173,456 L179R probably damaging Het
Nlrp1c-ps A G 11: 71,246,362 noncoding transcript Het
Nwd2 A T 5: 63,805,574 M834L probably benign Het
Olfr1361 A G 13: 21,658,831 M164T probably damaging Het
Olfr517 A T 7: 108,869,016 M46K probably benign Het
Pccb T C 9: 100,994,632 E266G probably benign Het
Pcdhb2 T A 18: 37,297,244 probably null Het
Prdm13 A C 4: 21,683,914 I119S unknown Het
Tchh A G 3: 93,442,382 Y18C probably damaging Het
Tmem192 T C 8: 64,959,346 V59A probably damaging Het
Trak2 A T 1: 58,935,757 F92Y probably damaging Het
Trappc11 C T 8: 47,505,736 G40D probably damaging Het
Ttc23 A T 7: 67,669,787 I132F probably benign Het
Ttc9b A G 7: 27,655,980 D225G probably benign Het
Ubr3 G T 2: 69,897,260 probably benign Het
Vmn2r75 A C 7: 86,148,936 C556W probably damaging Het
Zbtb41 T C 1: 139,440,359 V595A probably damaging Het
Other mutations in Dvl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Dvl1 APN 4 155853698 missense possibly damaging 0.85
IGL01930:Dvl1 APN 4 155856188 missense possibly damaging 0.72
IGL02499:Dvl1 APN 4 155854780 missense probably benign 0.10
IGL03075:Dvl1 APN 4 155854583 missense probably damaging 0.99
IGL03089:Dvl1 APN 4 155855152 missense probably damaging 1.00
R0525:Dvl1 UTSW 4 155855595 missense probably damaging 0.99
R0624:Dvl1 UTSW 4 155854775 missense probably damaging 1.00
R0633:Dvl1 UTSW 4 155858295 missense probably damaging 1.00
R1459:Dvl1 UTSW 4 155854019 missense probably damaging 0.99
R1955:Dvl1 UTSW 4 155858029 missense possibly damaging 0.69
R1991:Dvl1 UTSW 4 155847816 missense possibly damaging 0.84
R2144:Dvl1 UTSW 4 155847816 missense possibly damaging 0.84
R2145:Dvl1 UTSW 4 155847816 missense possibly damaging 0.84
R2156:Dvl1 UTSW 4 155847816 missense possibly damaging 0.84
R2191:Dvl1 UTSW 4 155847816 missense possibly damaging 0.84
R2192:Dvl1 UTSW 4 155847816 missense possibly damaging 0.84
R2290:Dvl1 UTSW 4 155847816 missense possibly damaging 0.84
R2304:Dvl1 UTSW 4 155855584 missense probably damaging 0.98
R2519:Dvl1 UTSW 4 155855543 nonsense probably null
R3082:Dvl1 UTSW 4 155847859 missense possibly damaging 0.92
R3110:Dvl1 UTSW 4 155853666 missense probably damaging 0.98
R3112:Dvl1 UTSW 4 155853666 missense probably damaging 0.98
R4775:Dvl1 UTSW 4 155858127 missense probably benign
R5384:Dvl1 UTSW 4 155853686 missense probably damaging 0.99
R6148:Dvl1 UTSW 4 155854952 missense probably damaging 1.00
R6563:Dvl1 UTSW 4 155856253 missense probably damaging 1.00
R7293:Dvl1 UTSW 4 155856168 missense possibly damaging 0.93
R7746:Dvl1 UTSW 4 155856239 missense possibly damaging 0.93
R8385:Dvl1 UTSW 4 155855580 missense possibly damaging 0.68
Z1176:Dvl1 UTSW 4 155855611 missense probably benign 0.04
Z1177:Dvl1 UTSW 4 155847637 intron probably benign
Predicted Primers PCR Primer
(F):5'- TCAGAGCCGCTTTCCCTGG -3'
(R):5'- TTGCCACACTCAGGGTCAC -3'

Sequencing Primer
(F):5'- CGACAGGCGGGGAACGG -3'
(R):5'- TACACCTGCTGTAGATGCGCAG -3'
Posted On2014-10-30