Incidental Mutation 'R2292:Ddx55'
ID245028
Institutional Source Beutler Lab
Gene Symbol Ddx55
Ensembl Gene ENSMUSG00000029389
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 55
Synonyms2810021H22Rik
MMRRC Submission 040291-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2292 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location124552864-124569660 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 124568077 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 522 (A522S)
Ref Sequence ENSEMBL: ENSMUSP00000107065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031334] [ENSMUST00000071057] [ENSMUST00000111438] [ENSMUST00000131631]
Predicted Effect probably benign
Transcript: ENSMUST00000031334
SMART Domains Protein: ENSMUSP00000031334
Gene: ENSMUSG00000029388

DomainStartEndE-ValueType
Pfam:IF-2B 14 293 2.3e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071057
AA Change: A526S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000070279
Gene: ENSMUSG00000029389
AA Change: A526S

DomainStartEndE-ValueType
DEXDc 28 245 3.15e-51 SMART
HELICc 281 363 3.69e-25 SMART
DUF4217 402 465 1.44e-26 SMART
low complexity region 491 506 N/A INTRINSIC
low complexity region 517 540 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111438
AA Change: A522S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000107065
Gene: ENSMUSG00000029389
AA Change: A522S

DomainStartEndE-ValueType
DEXDc 28 245 3.15e-51 SMART
HELICc 281 363 3.69e-25 SMART
DUF4217 398 461 1.44e-26 SMART
low complexity region 487 502 N/A INTRINSIC
low complexity region 513 536 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131631
SMART Domains Protein: ENSMUSP00000143462
Gene: ENSMUSG00000029389

DomainStartEndE-ValueType
Pfam:DEAD 33 125 6.4e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142451
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152716
Meta Mutation Damage Score 0.0697 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of protein family containing a characteristic Asp-Glu-Ala-Asp (DEAD) motif. These proteins are putative RNA helicases, and may be involved in a range of nuclear processes including translational initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Multiple alternatively spliced transcript variants have been found for this gene. Pseudogenes have been identified on chromosomes 1 and 12. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,732,139 I370T probably benign Het
A2m A G 6: 121,673,559 T1209A possibly damaging Het
Als2 T C 1: 59,187,385 Q920R probably damaging Het
Arhgap20 T A 9: 51,849,443 Y829N possibly damaging Het
Arhgap35 A T 7: 16,563,551 F530I probably damaging Het
Arid4a G T 12: 71,061,541 G40V probably damaging Het
Ascc2 T C 11: 4,679,352 probably benign Het
Cacna1b C T 2: 24,606,620 V2312I probably benign Het
Dctn6 T C 8: 34,092,525 T159A probably benign Het
Dnah6 G A 6: 73,021,109 T4110I probably damaging Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Dym A G 18: 75,199,212 T504A possibly damaging Het
E130308A19Rik T C 4: 59,690,579 Y138H probably damaging Het
Fgd4 A T 16: 16,436,000 C568S possibly damaging Het
Fkbp4 A C 6: 128,436,662 V6G probably damaging Het
Flg2 A T 3: 93,220,677 S2299C unknown Het
Gdf2 A T 14: 33,945,188 N289I possibly damaging Het
Gm13023 T C 4: 143,793,876 I66T probably benign Het
Gpr182 A G 10: 127,750,182 I300T possibly damaging Het
Iqcg A G 16: 33,049,883 V80A probably benign Het
Letm1 A AG 5: 33,769,515 probably null Het
Lyst T G 13: 13,740,495 F3258C probably damaging Het
Map3k12 T C 15: 102,500,139 E870G probably damaging Het
Mphosph10 G A 7: 64,385,771 P384L probably damaging Het
Ncoa4 T G 14: 32,173,456 L179R probably damaging Het
Nlrp1c-ps A G 11: 71,246,362 noncoding transcript Het
Nwd2 A T 5: 63,805,574 M834L probably benign Het
Olfr1361 A G 13: 21,658,831 M164T probably damaging Het
Olfr517 A T 7: 108,869,016 M46K probably benign Het
Pccb T C 9: 100,994,632 E266G probably benign Het
Pcdhb2 T A 18: 37,297,244 probably null Het
Prdm13 A C 4: 21,683,914 I119S unknown Het
Tchh A G 3: 93,442,382 Y18C probably damaging Het
Tmem192 T C 8: 64,959,346 V59A probably damaging Het
Trak2 A T 1: 58,935,757 F92Y probably damaging Het
Trappc11 C T 8: 47,505,736 G40D probably damaging Het
Ttc23 A T 7: 67,669,787 I132F probably benign Het
Ttc9b A G 7: 27,655,980 D225G probably benign Het
Ubr3 G T 2: 69,897,260 probably benign Het
Vmn2r75 A C 7: 86,148,936 C556W probably damaging Het
Zbtb41 T C 1: 139,440,359 V595A probably damaging Het
Other mutations in Ddx55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02237:Ddx55 APN 5 124567895 missense probably damaging 1.00
IGL03356:Ddx55 APN 5 124554753 missense possibly damaging 0.95
R0100:Ddx55 UTSW 5 124556782 missense probably damaging 1.00
R0100:Ddx55 UTSW 5 124556782 missense probably damaging 1.00
R0329:Ddx55 UTSW 5 124559147 missense probably benign 0.00
R0401:Ddx55 UTSW 5 124567951 missense probably damaging 1.00
R1604:Ddx55 UTSW 5 124559306 missense probably damaging 1.00
R1760:Ddx55 UTSW 5 124568113 missense probably damaging 0.99
R2002:Ddx55 UTSW 5 124566440 missense probably damaging 1.00
R4677:Ddx55 UTSW 5 124567934 missense probably benign 0.04
R4735:Ddx55 UTSW 5 124566476 missense probably damaging 1.00
R4745:Ddx55 UTSW 5 124566965 nonsense probably null
R4941:Ddx55 UTSW 5 124568716 nonsense probably null
R5272:Ddx55 UTSW 5 124558029 missense possibly damaging 0.91
R5348:Ddx55 UTSW 5 124554565 missense probably damaging 0.96
R5514:Ddx55 UTSW 5 124556812 missense probably damaging 1.00
R5801:Ddx55 UTSW 5 124566497 critical splice donor site probably null
R5806:Ddx55 UTSW 5 124559199 missense probably damaging 1.00
R5869:Ddx55 UTSW 5 124568682 missense probably benign
R5909:Ddx55 UTSW 5 124566850 missense probably benign 0.00
R6594:Ddx55 UTSW 5 124566925 missense probably damaging 1.00
R6737:Ddx55 UTSW 5 124552945 missense probably damaging 1.00
R7257:Ddx55 UTSW 5 124560721 missense possibly damaging 0.67
R7262:Ddx55 UTSW 5 124566856 missense probably benign
R8049:Ddx55 UTSW 5 124556758 missense probably damaging 0.96
R8078:Ddx55 UTSW 5 124566388 missense probably damaging 1.00
R8093:Ddx55 UTSW 5 124556820 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- AGCAGTTTCCTGACTTTGTACCAG -3'
(R):5'- GCAATGTCACAAGGTGGAGTTG -3'

Sequencing Primer
(F):5'- TTGTACCAGTGGACATCGATACCG -3'
(R):5'- CAACACATTACCTCATCCTT -3'
Posted On2014-10-30