Incidental Mutation 'R2292:Fkbp4'
ID 245031
Institutional Source Beutler Lab
Gene Symbol Fkbp4
Ensembl Gene ENSMUSG00000030357
Gene Name FK506 binding protein 4
Synonyms FKBP-52, FKBP52
MMRRC Submission 040291-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.833) question?
Stock # R2292 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 128407066-128415619 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 128413625 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 6 (V6G)
Ref Sequence ENSEMBL: ENSMUSP00000122087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032508] [ENSMUST00000150387] [ENSMUST00000151796]
AlphaFold P30416
Predicted Effect probably damaging
Transcript: ENSMUST00000032508
AA Change: V53G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032508
Gene: ENSMUSG00000030357
AA Change: V53G

DomainStartEndE-ValueType
Pfam:FKBP_C 43 135 2.6e-33 PFAM
Pfam:FKBP_C 160 250 1.3e-14 PFAM
TPR 270 303 4.44e1 SMART
TPR 319 352 1.76e-5 SMART
TPR 353 386 2e-4 SMART
low complexity region 419 431 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139448
SMART Domains Protein: ENSMUSP00000114939
Gene: ENSMUSG00000030357

DomainStartEndE-ValueType
Pfam:FKBP_C 43 135 3.8e-33 PFAM
Pfam:FKBP_C 160 250 2.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144745
Predicted Effect probably damaging
Transcript: ENSMUST00000150387
AA Change: V6G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119930
Gene: ENSMUSG00000030357
AA Change: V6G

DomainStartEndE-ValueType
Pfam:FKBP_C 1 88 7.8e-31 PFAM
Pfam:FKBP_C 113 203 4.7e-13 PFAM
Blast:TPR 223 256 3e-14 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000151796
AA Change: V6G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122087
Gene: ENSMUSG00000030357
AA Change: V6G

DomainStartEndE-ValueType
Pfam:FKBP_C 1 88 3.7e-31 PFAM
Pfam:FKBP_C 113 187 3.2e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204081
Meta Mutation Damage Score 0.9117 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. This encoded protein is a cis-trans prolyl isomerase that binds to the immunosuppressants FK506 and rapamycin. It has high structural and functional similarity to FK506-binding protein 1A (FKBP1A), but unlike FKBP1A, this protein does not have immunosuppressant activity when complexed with FK506. It interacts with interferon regulatory factor-4 and plays an important role in immunoregulatory gene expression in B and T lymphocytes. This encoded protein is known to associate with phytanoyl-CoA alpha-hydroxylase. It can also associate with two heat shock proteins (hsp90 and hsp70) and thus may play a role in the intracellular trafficking of hetero-oligomeric forms of the steroid hormone receptors. This protein correlates strongly with adeno-associated virus type 2 vectors (AAV) resulting in a significant increase in AAV-mediated transgene expression in human cell lines. Thus this encoded protein is thought to have important implications for the optimal use of AAV vectors in human gene therapy. The human genome contains several non-transcribed pseudogenes similar to this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Homozygous null males show reproductive tissue defects consistent with androgen insensitivity such as ambiguous external genitalia, dysgenic prostate, malformed seminal gland and cryptorchism. Males also exhibit hypospadia and infertility. Females are sterile due to failure of implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,562,483 (GRCm39) I370T probably benign Het
A2m A G 6: 121,650,518 (GRCm39) T1209A possibly damaging Het
Als2 T C 1: 59,226,544 (GRCm39) Q920R probably damaging Het
Arhgap20 T A 9: 51,760,743 (GRCm39) Y829N possibly damaging Het
Arhgap35 A T 7: 16,297,476 (GRCm39) F530I probably damaging Het
Arid4a G T 12: 71,108,315 (GRCm39) G40V probably damaging Het
Ascc2 T C 11: 4,629,352 (GRCm39) probably benign Het
Cacna1b C T 2: 24,496,632 (GRCm39) V2312I probably benign Het
Dctn6 T C 8: 34,559,679 (GRCm39) T159A probably benign Het
Ddx55 G T 5: 124,706,140 (GRCm39) A522S probably benign Het
Dnah6 G A 6: 72,998,092 (GRCm39) T4110I probably damaging Het
Dvl1 G A 4: 155,932,273 (GRCm39) V28I possibly damaging Het
Dym A G 18: 75,332,283 (GRCm39) T504A possibly damaging Het
E130308A19Rik T C 4: 59,690,579 (GRCm39) Y138H probably damaging Het
Fgd4 A T 16: 16,253,864 (GRCm39) C568S possibly damaging Het
Flg2 A T 3: 93,127,984 (GRCm39) S2299C unknown Het
Gdf2 A T 14: 33,667,145 (GRCm39) N289I possibly damaging Het
Gpr182 A G 10: 127,586,051 (GRCm39) I300T possibly damaging Het
Iqcg A G 16: 32,870,253 (GRCm39) V80A probably benign Het
Letm1 A AG 5: 33,926,859 (GRCm39) probably null Het
Lyst T G 13: 13,915,080 (GRCm39) F3258C probably damaging Het
Map3k12 T C 15: 102,408,574 (GRCm39) E870G probably damaging Het
Mphosph10 G A 7: 64,035,519 (GRCm39) P384L probably damaging Het
Ncoa4 T G 14: 31,895,413 (GRCm39) L179R probably damaging Het
Nlrp1c-ps A G 11: 71,137,188 (GRCm39) noncoding transcript Het
Nwd2 A T 5: 63,962,917 (GRCm39) M834L probably benign Het
Or10a49 A T 7: 108,468,223 (GRCm39) M46K probably benign Het
Or2w6 A G 13: 21,843,001 (GRCm39) M164T probably damaging Het
Pccb T C 9: 100,876,685 (GRCm39) E266G probably benign Het
Pcdhb2 T A 18: 37,430,297 (GRCm39) probably null Het
Pramel25 T C 4: 143,520,446 (GRCm39) I66T probably benign Het
Prdm13 A C 4: 21,683,914 (GRCm39) I119S unknown Het
Tchh A G 3: 93,349,689 (GRCm39) Y18C probably damaging Het
Tmem192 T C 8: 65,411,998 (GRCm39) V59A probably damaging Het
Trak2 A T 1: 58,974,916 (GRCm39) F92Y probably damaging Het
Trappc11 C T 8: 47,958,771 (GRCm39) G40D probably damaging Het
Ttc23 A T 7: 67,319,535 (GRCm39) I132F probably benign Het
Ttc9b A G 7: 27,355,405 (GRCm39) D225G probably benign Het
Ubr3 G T 2: 69,727,604 (GRCm39) probably benign Het
Vmn2r75 A C 7: 85,798,144 (GRCm39) C556W probably damaging Het
Zbtb41 T C 1: 139,368,097 (GRCm39) V595A probably damaging Het
Other mutations in Fkbp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01151:Fkbp4 APN 6 128,412,754 (GRCm39) missense probably benign 0.28
IGL02215:Fkbp4 APN 6 128,411,433 (GRCm39) splice site probably benign
IGL02607:Fkbp4 APN 6 128,411,433 (GRCm39) splice site probably benign
IGL03186:Fkbp4 APN 6 128,411,763 (GRCm39) missense probably benign
IGL03238:Fkbp4 APN 6 128,411,720 (GRCm39) missense probably damaging 1.00
R0083:Fkbp4 UTSW 6 128,409,370 (GRCm39) unclassified probably benign
R0491:Fkbp4 UTSW 6 128,412,705 (GRCm39) missense probably damaging 1.00
R1652:Fkbp4 UTSW 6 128,413,637 (GRCm39) missense probably damaging 0.97
R1868:Fkbp4 UTSW 6 128,409,453 (GRCm39) missense probably benign 0.00
R2010:Fkbp4 UTSW 6 128,412,765 (GRCm39) missense probably benign 0.01
R5616:Fkbp4 UTSW 6 128,410,517 (GRCm39) missense probably damaging 0.99
R6478:Fkbp4 UTSW 6 128,410,194 (GRCm39) missense probably damaging 1.00
R7156:Fkbp4 UTSW 6 128,412,787 (GRCm39) missense probably benign 0.31
R9182:Fkbp4 UTSW 6 128,415,382 (GRCm39) missense probably benign
R9445:Fkbp4 UTSW 6 128,413,580 (GRCm39) missense probably damaging 1.00
R9739:Fkbp4 UTSW 6 128,410,728 (GRCm39) missense probably benign 0.00
Z1177:Fkbp4 UTSW 6 128,410,074 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGCTTCCTTCTGGTGGCC -3'
(R):5'- TCGGACCTGCTGAAAAGAAGC -3'

Sequencing Primer
(F):5'- AATCTCTGGTCGCTGGAAAC -3'
(R):5'- GCAGGGGGCAGTGGGTG -3'
Posted On 2014-10-30