Incidental Mutation 'R2292:Ttc23'
ID245037
Institutional Source Beutler Lab
Gene Symbol Ttc23
Ensembl Gene ENSMUSG00000030555
Gene Nametetratricopeptide repeat domain 23
Synonyms
MMRRC Submission 040291-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R2292 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location67647410-67762912 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67669787 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 132 (I132F)
Ref Sequence ENSEMBL: ENSMUSP00000103095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032774] [ENSMUST00000107470] [ENSMUST00000107471]
Predicted Effect probably benign
Transcript: ENSMUST00000032774
AA Change: I132F

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000032774
Gene: ENSMUSG00000030555
AA Change: I132F

DomainStartEndE-ValueType
Blast:TPR 45 78 5e-10 BLAST
SCOP:d1a17__ 50 214 6e-8 SMART
Blast:TPR 87 121 3e-10 BLAST
Blast:TPR 137 170 3e-8 BLAST
Blast:TPR 186 219 1e-6 BLAST
low complexity region 310 323 N/A INTRINSIC
Blast:TPR 398 431 5e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000107470
AA Change: I132F

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000103094
Gene: ENSMUSG00000030555
AA Change: I132F

DomainStartEndE-ValueType
Blast:TPR 45 78 4e-10 BLAST
Blast:TPR 87 121 2e-10 BLAST
Blast:TPR 137 170 3e-8 BLAST
Pfam:TPR_12 185 257 5.9e-10 PFAM
low complexity region 268 281 N/A INTRINSIC
Blast:TPR 356 389 5e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000107471
AA Change: I132F

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000103095
Gene: ENSMUSG00000030555
AA Change: I132F

DomainStartEndE-ValueType
Blast:TPR 45 78 4e-10 BLAST
Blast:TPR 87 121 2e-10 BLAST
Blast:TPR 137 170 3e-8 BLAST
Pfam:TPR_12 185 257 5.9e-10 PFAM
low complexity region 268 281 N/A INTRINSIC
Blast:TPR 356 389 5e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126093
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130681
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133710
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145348
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153475
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155024
Predicted Effect probably benign
Transcript: ENSMUST00000208764
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,732,139 I370T probably benign Het
A2m A G 6: 121,673,559 T1209A possibly damaging Het
Als2 T C 1: 59,187,385 Q920R probably damaging Het
Arhgap20 T A 9: 51,849,443 Y829N possibly damaging Het
Arhgap35 A T 7: 16,563,551 F530I probably damaging Het
Arid4a G T 12: 71,061,541 G40V probably damaging Het
Ascc2 T C 11: 4,679,352 probably benign Het
Cacna1b C T 2: 24,606,620 V2312I probably benign Het
Dctn6 T C 8: 34,092,525 T159A probably benign Het
Ddx55 G T 5: 124,568,077 A522S probably benign Het
Dnah6 G A 6: 73,021,109 T4110I probably damaging Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Dym A G 18: 75,199,212 T504A possibly damaging Het
E130308A19Rik T C 4: 59,690,579 Y138H probably damaging Het
Fgd4 A T 16: 16,436,000 C568S possibly damaging Het
Fkbp4 A C 6: 128,436,662 V6G probably damaging Het
Flg2 A T 3: 93,220,677 S2299C unknown Het
Gdf2 A T 14: 33,945,188 N289I possibly damaging Het
Gm13023 T C 4: 143,793,876 I66T probably benign Het
Gpr182 A G 10: 127,750,182 I300T possibly damaging Het
Iqcg A G 16: 33,049,883 V80A probably benign Het
Letm1 A AG 5: 33,769,515 probably null Het
Lyst T G 13: 13,740,495 F3258C probably damaging Het
Map3k12 T C 15: 102,500,139 E870G probably damaging Het
Mphosph10 G A 7: 64,385,771 P384L probably damaging Het
Ncoa4 T G 14: 32,173,456 L179R probably damaging Het
Nlrp1c-ps A G 11: 71,246,362 noncoding transcript Het
Nwd2 A T 5: 63,805,574 M834L probably benign Het
Olfr1361 A G 13: 21,658,831 M164T probably damaging Het
Olfr517 A T 7: 108,869,016 M46K probably benign Het
Pccb T C 9: 100,994,632 E266G probably benign Het
Pcdhb2 T A 18: 37,297,244 probably null Het
Prdm13 A C 4: 21,683,914 I119S unknown Het
Tchh A G 3: 93,442,382 Y18C probably damaging Het
Tmem192 T C 8: 64,959,346 V59A probably damaging Het
Trak2 A T 1: 58,935,757 F92Y probably damaging Het
Trappc11 C T 8: 47,505,736 G40D probably damaging Het
Ttc9b A G 7: 27,655,980 D225G probably benign Het
Ubr3 G T 2: 69,897,260 probably benign Het
Vmn2r75 A C 7: 86,148,936 C556W probably damaging Het
Zbtb41 T C 1: 139,440,359 V595A probably damaging Het
Other mutations in Ttc23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02852:Ttc23 APN 7 67667155 unclassified probably benign
IGL03257:Ttc23 APN 7 67711378 missense probably damaging 1.00
IGL03365:Ttc23 APN 7 67662337 utr 5 prime probably benign
IGL03404:Ttc23 APN 7 67678897 missense probably damaging 0.99
F5770:Ttc23 UTSW 7 67709315 splice site probably benign
PIT4445001:Ttc23 UTSW 7 67667213 missense probably damaging 1.00
PIT4791001:Ttc23 UTSW 7 67662387 missense probably damaging 1.00
R0295:Ttc23 UTSW 7 67669852 unclassified probably benign
R0316:Ttc23 UTSW 7 67679073 critical splice donor site probably null
R0336:Ttc23 UTSW 7 67662483 missense probably benign 0.01
R1456:Ttc23 UTSW 7 67667154 unclassified probably benign
R1543:Ttc23 UTSW 7 67678995 missense probably benign 0.01
R1662:Ttc23 UTSW 7 67725321 splice site probably null
R1708:Ttc23 UTSW 7 67667176 missense probably damaging 0.99
R1857:Ttc23 UTSW 7 67679073 critical splice donor site probably null
R4471:Ttc23 UTSW 7 67670156 missense probably benign 0.37
R6036:Ttc23 UTSW 7 67711366 missense possibly damaging 0.85
R6036:Ttc23 UTSW 7 67711366 missense possibly damaging 0.85
R6841:Ttc23 UTSW 7 67669728 missense possibly damaging 0.91
R7690:Ttc23 UTSW 7 67670170 missense possibly damaging 0.76
R8305:Ttc23 UTSW 7 67662387 missense probably damaging 0.99
RF009:Ttc23 UTSW 7 67726029 missense possibly damaging 0.61
X0021:Ttc23 UTSW 7 67670131 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTACATGCCAGGCTTCCC -3'
(R):5'- GGTTCAGGAAAAGTCTTGCCTATTC -3'

Sequencing Primer
(F):5'- GCTTCCCAGGCACGGAG -3'
(R):5'- CTTCTTCTTCCTCATACAATACTTCC -3'
Posted On2014-10-30