Incidental Mutation 'R2292:Dctn6'
ID245040
Institutional Source Beutler Lab
Gene Symbol Dctn6
Ensembl Gene ENSMUSG00000031516
Gene Namedynactin 6
SynonymsWS-3, p27
MMRRC Submission 040291-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2292 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location34090420-34108796 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34092525 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 159 (T159A)
Ref Sequence ENSEMBL: ENSMUSP00000113716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033913] [ENSMUST00000117243] [ENSMUST00000118811] [ENSMUST00000143411]
Predicted Effect probably benign
Transcript: ENSMUST00000033913
AA Change: T154A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000033913
Gene: ENSMUSG00000031516
AA Change: T154A

DomainStartEndE-ValueType
Pfam:Hexapep 8 43 3.3e-5 PFAM
Pfam:Hexapep 98 133 3.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117243
AA Change: T159A

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000113716
Gene: ENSMUSG00000031516
AA Change: T159A

DomainStartEndE-ValueType
low complexity region 46 58 N/A INTRINSIC
Pfam:Hexapep 103 138 2.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118811
AA Change: T149A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113280
Gene: ENSMUSG00000031516
AA Change: T149A

DomainStartEndE-ValueType
Pfam:Hexapep 3 38 4.7e-6 PFAM
Pfam:Hexapep 93 128 5.7e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123113
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142661
Predicted Effect probably benign
Transcript: ENSMUST00000143411
SMART Domains Protein: ENSMUSP00000117109
Gene: ENSMUSG00000031516

DomainStartEndE-ValueType
PDB:3TV0|B 1 103 3e-35 PDB
Predicted Effect unknown
Transcript: ENSMUST00000152422
AA Change: T135A
SMART Domains Protein: ENSMUSP00000120022
Gene: ENSMUSG00000031516
AA Change: T135A

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
Pfam:Hexapep 80 115 1.6e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181097
Meta Mutation Damage Score 0.0584 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains an RGD (Arg-Gly-Asp) motif in the N-terminal region, which confers adhesive properties to macromolecular proteins like fibronectin. It shares a high degree of sequence similarity with the mouse homolog, which has been suggested to play a role in mitochondrial biogenesis. The exact biological function of this gene is not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,732,139 I370T probably benign Het
A2m A G 6: 121,673,559 T1209A possibly damaging Het
Als2 T C 1: 59,187,385 Q920R probably damaging Het
Arhgap20 T A 9: 51,849,443 Y829N possibly damaging Het
Arhgap35 A T 7: 16,563,551 F530I probably damaging Het
Arid4a G T 12: 71,061,541 G40V probably damaging Het
Ascc2 T C 11: 4,679,352 probably benign Het
Cacna1b C T 2: 24,606,620 V2312I probably benign Het
Ddx55 G T 5: 124,568,077 A522S probably benign Het
Dnah6 G A 6: 73,021,109 T4110I probably damaging Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Dym A G 18: 75,199,212 T504A possibly damaging Het
E130308A19Rik T C 4: 59,690,579 Y138H probably damaging Het
Fgd4 A T 16: 16,436,000 C568S possibly damaging Het
Fkbp4 A C 6: 128,436,662 V6G probably damaging Het
Flg2 A T 3: 93,220,677 S2299C unknown Het
Gdf2 A T 14: 33,945,188 N289I possibly damaging Het
Gm13023 T C 4: 143,793,876 I66T probably benign Het
Gpr182 A G 10: 127,750,182 I300T possibly damaging Het
Iqcg A G 16: 33,049,883 V80A probably benign Het
Letm1 A AG 5: 33,769,515 probably null Het
Lyst T G 13: 13,740,495 F3258C probably damaging Het
Map3k12 T C 15: 102,500,139 E870G probably damaging Het
Mphosph10 G A 7: 64,385,771 P384L probably damaging Het
Ncoa4 T G 14: 32,173,456 L179R probably damaging Het
Nlrp1c-ps A G 11: 71,246,362 noncoding transcript Het
Nwd2 A T 5: 63,805,574 M834L probably benign Het
Olfr1361 A G 13: 21,658,831 M164T probably damaging Het
Olfr517 A T 7: 108,869,016 M46K probably benign Het
Pccb T C 9: 100,994,632 E266G probably benign Het
Pcdhb2 T A 18: 37,297,244 probably null Het
Prdm13 A C 4: 21,683,914 I119S unknown Het
Tchh A G 3: 93,442,382 Y18C probably damaging Het
Tmem192 T C 8: 64,959,346 V59A probably damaging Het
Trak2 A T 1: 58,935,757 F92Y probably damaging Het
Trappc11 C T 8: 47,505,736 G40D probably damaging Het
Ttc23 A T 7: 67,669,787 I132F probably benign Het
Ttc9b A G 7: 27,655,980 D225G probably benign Het
Ubr3 G T 2: 69,897,260 probably benign Het
Vmn2r75 A C 7: 86,148,936 C556W probably damaging Het
Zbtb41 T C 1: 139,440,359 V595A probably damaging Het
Other mutations in Dctn6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Dctn6 APN 8 34092593 missense probably damaging 1.00
R4868:Dctn6 UTSW 8 34092076 unclassified probably benign
R5408:Dctn6 UTSW 8 34094902 missense possibly damaging 0.80
R5460:Dctn6 UTSW 8 34104981 splice site probably null
R5862:Dctn6 UTSW 8 34108417 critical splice donor site probably null
R6265:Dctn6 UTSW 8 34094903 missense probably damaging 1.00
R7256:Dctn6 UTSW 8 34090808 missense probably damaging 1.00
RF031:Dctn6 UTSW 8 34105082 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- CCCGTCAGTATCACACATGC -3'
(R):5'- GTGAGGAATGTCCATGCTTTC -3'

Sequencing Primer
(F):5'- GAACTGTGAACTGCAAATAAATCC -3'
(R):5'- CTTGATGTCTTAAGCTGTAACTGTC -3'
Posted On2014-10-30