Incidental Mutation 'R2292:Tmem192'
ID245042
Institutional Source Beutler Lab
Gene Symbol Tmem192
Ensembl Gene ENSMUSG00000025521
Gene Nametransmembrane protein 192
Synonyms
MMRRC Submission 040291-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R2292 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location64947185-64969033 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64959346 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 59 (V59A)
Ref Sequence ENSEMBL: ENSMUSP00000147788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026595] [ENSMUST00000079896] [ENSMUST00000209852] [ENSMUST00000209923] [ENSMUST00000211405]
Predicted Effect probably damaging
Transcript: ENSMUST00000026595
AA Change: V59A

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000026595
Gene: ENSMUSG00000025521
AA Change: V59A

DomainStartEndE-ValueType
Pfam:TMEM192 26 259 3.6e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000079896
AA Change: V59A

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000078819
Gene: ENSMUSG00000025521
AA Change: V59A

DomainStartEndE-ValueType
Pfam:TMEM192 25 148 7e-35 PFAM
Pfam:TMEM192 146 215 1.4e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209852
AA Change: V59A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000209923
Predicted Effect probably benign
Transcript: ENSMUST00000211405
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 100% (44/44)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-put allele are viable and overtly normal with no signs of pathology or lysosomal dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,732,139 I370T probably benign Het
A2m A G 6: 121,673,559 T1209A possibly damaging Het
Als2 T C 1: 59,187,385 Q920R probably damaging Het
Arhgap20 T A 9: 51,849,443 Y829N possibly damaging Het
Arhgap35 A T 7: 16,563,551 F530I probably damaging Het
Arid4a G T 12: 71,061,541 G40V probably damaging Het
Ascc2 T C 11: 4,679,352 probably benign Het
Cacna1b C T 2: 24,606,620 V2312I probably benign Het
Dctn6 T C 8: 34,092,525 T159A probably benign Het
Ddx55 G T 5: 124,568,077 A522S probably benign Het
Dnah6 G A 6: 73,021,109 T4110I probably damaging Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Dym A G 18: 75,199,212 T504A possibly damaging Het
E130308A19Rik T C 4: 59,690,579 Y138H probably damaging Het
Fgd4 A T 16: 16,436,000 C568S possibly damaging Het
Fkbp4 A C 6: 128,436,662 V6G probably damaging Het
Flg2 A T 3: 93,220,677 S2299C unknown Het
Gdf2 A T 14: 33,945,188 N289I possibly damaging Het
Gm13023 T C 4: 143,793,876 I66T probably benign Het
Gpr182 A G 10: 127,750,182 I300T possibly damaging Het
Iqcg A G 16: 33,049,883 V80A probably benign Het
Letm1 A AG 5: 33,769,515 probably null Het
Lyst T G 13: 13,740,495 F3258C probably damaging Het
Map3k12 T C 15: 102,500,139 E870G probably damaging Het
Mphosph10 G A 7: 64,385,771 P384L probably damaging Het
Ncoa4 T G 14: 32,173,456 L179R probably damaging Het
Nlrp1c-ps A G 11: 71,246,362 noncoding transcript Het
Nwd2 A T 5: 63,805,574 M834L probably benign Het
Olfr1361 A G 13: 21,658,831 M164T probably damaging Het
Olfr517 A T 7: 108,869,016 M46K probably benign Het
Pccb T C 9: 100,994,632 E266G probably benign Het
Pcdhb2 T A 18: 37,297,244 probably null Het
Prdm13 A C 4: 21,683,914 I119S unknown Het
Tchh A G 3: 93,442,382 Y18C probably damaging Het
Trak2 A T 1: 58,935,757 F92Y probably damaging Het
Trappc11 C T 8: 47,505,736 G40D probably damaging Het
Ttc23 A T 7: 67,669,787 I132F probably benign Het
Ttc9b A G 7: 27,655,980 D225G probably benign Het
Ubr3 G T 2: 69,897,260 probably benign Het
Vmn2r75 A C 7: 86,148,936 C556W probably damaging Het
Zbtb41 T C 1: 139,440,359 V595A probably damaging Het
Other mutations in Tmem192
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02996:Tmem192 APN 8 64968790 unclassified probably null
R0541:Tmem192 UTSW 8 64964260 missense probably damaging 1.00
R1837:Tmem192 UTSW 8 64964340 splice site probably benign
R1920:Tmem192 UTSW 8 64965583 missense probably damaging 1.00
R5032:Tmem192 UTSW 8 64959511 missense possibly damaging 0.77
R5505:Tmem192 UTSW 8 64964246 missense possibly damaging 0.58
R5591:Tmem192 UTSW 8 64965602 missense possibly damaging 0.60
R6767:Tmem192 UTSW 8 64964236 missense probably damaging 1.00
R8077:Tmem192 UTSW 8 64965544 missense probably benign 0.01
R8261:Tmem192 UTSW 8 64964320 missense probably benign
X0052:Tmem192 UTSW 8 64959418 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTGAGTGTGCATGGTCATACC -3'
(R):5'- CCTGTGGTGATACTGGACGTAG -3'

Sequencing Primer
(F):5'- CATGGTCATACCTGTATGCATGGAAG -3'
(R):5'- TGATACTGGACGTAGCGTTC -3'
Posted On2014-10-30