Incidental Mutation 'R2292:Arhgap20'
ID245043
Institutional Source Beutler Lab
Gene Symbol Arhgap20
Ensembl Gene ENSMUSG00000053199
Gene NameRho GTPase activating protein 20
Synonyms6530403F17Rik, A530023E23Rik
MMRRC Submission 040291-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.323) question?
Stock #R2292 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location51765337-51853856 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 51849443 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 829 (Y829N)
Ref Sequence ENSEMBL: ENSMUSP00000120124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065496] [ENSMUST00000130405]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065496
AA Change: Y865N

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000065633
Gene: ENSMUSG00000053199
AA Change: Y865N

DomainStartEndE-ValueType
PH 86 187 3.31e-5 SMART
Pfam:RA 194 283 3.6e-15 PFAM
RhoGAP 374 548 1.27e-41 SMART
internal_repeat_1 655 779 9.97e-15 PROSPERO
internal_repeat_1 797 922 9.97e-15 PROSPERO
low complexity region 935 962 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130086
Predicted Effect possibly damaging
Transcript: ENSMUST00000130405
AA Change: Y829N

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000120124
Gene: ENSMUSG00000053199
AA Change: Y829N

DomainStartEndE-ValueType
PH 50 151 3.31e-5 SMART
Pfam:RA 158 247 3.3e-14 PFAM
RhoGAP 338 512 1.27e-41 SMART
internal_repeat_1 619 743 7.07e-15 PROSPERO
internal_repeat_1 761 886 7.07e-15 PROSPERO
low complexity region 899 926 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152203
Meta Mutation Damage Score 0.2000 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an activator of RHO-type GTPases, transducing a signal from RAP1 to RHO and impacting neurite outgrowth. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,732,139 I370T probably benign Het
A2m A G 6: 121,673,559 T1209A possibly damaging Het
Als2 T C 1: 59,187,385 Q920R probably damaging Het
Arhgap35 A T 7: 16,563,551 F530I probably damaging Het
Arid4a G T 12: 71,061,541 G40V probably damaging Het
Ascc2 T C 11: 4,679,352 probably benign Het
Cacna1b C T 2: 24,606,620 V2312I probably benign Het
Dctn6 T C 8: 34,092,525 T159A probably benign Het
Ddx55 G T 5: 124,568,077 A522S probably benign Het
Dnah6 G A 6: 73,021,109 T4110I probably damaging Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Dym A G 18: 75,199,212 T504A possibly damaging Het
E130308A19Rik T C 4: 59,690,579 Y138H probably damaging Het
Fgd4 A T 16: 16,436,000 C568S possibly damaging Het
Fkbp4 A C 6: 128,436,662 V6G probably damaging Het
Flg2 A T 3: 93,220,677 S2299C unknown Het
Gdf2 A T 14: 33,945,188 N289I possibly damaging Het
Gm13023 T C 4: 143,793,876 I66T probably benign Het
Gpr182 A G 10: 127,750,182 I300T possibly damaging Het
Iqcg A G 16: 33,049,883 V80A probably benign Het
Letm1 A AG 5: 33,769,515 probably null Het
Lyst T G 13: 13,740,495 F3258C probably damaging Het
Map3k12 T C 15: 102,500,139 E870G probably damaging Het
Mphosph10 G A 7: 64,385,771 P384L probably damaging Het
Ncoa4 T G 14: 32,173,456 L179R probably damaging Het
Nlrp1c-ps A G 11: 71,246,362 noncoding transcript Het
Nwd2 A T 5: 63,805,574 M834L probably benign Het
Olfr1361 A G 13: 21,658,831 M164T probably damaging Het
Olfr517 A T 7: 108,869,016 M46K probably benign Het
Pccb T C 9: 100,994,632 E266G probably benign Het
Pcdhb2 T A 18: 37,297,244 probably null Het
Prdm13 A C 4: 21,683,914 I119S unknown Het
Tchh A G 3: 93,442,382 Y18C probably damaging Het
Tmem192 T C 8: 64,959,346 V59A probably damaging Het
Trak2 A T 1: 58,935,757 F92Y probably damaging Het
Trappc11 C T 8: 47,505,736 G40D probably damaging Het
Ttc23 A T 7: 67,669,787 I132F probably benign Het
Ttc9b A G 7: 27,655,980 D225G probably benign Het
Ubr3 G T 2: 69,897,260 probably benign Het
Vmn2r75 A C 7: 86,148,936 C556W probably damaging Het
Zbtb41 T C 1: 139,440,359 V595A probably damaging Het
Other mutations in Arhgap20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Arhgap20 APN 9 51849413 missense probably benign 0.00
IGL01542:Arhgap20 APN 9 51838887 missense probably benign
IGL01815:Arhgap20 APN 9 51846168 missense probably damaging 1.00
IGL01975:Arhgap20 APN 9 51849797 nonsense probably null
IGL02041:Arhgap20 APN 9 51846190 missense possibly damaging 0.92
IGL02557:Arhgap20 APN 9 51821273 missense probably damaging 1.00
IGL02602:Arhgap20 APN 9 51825843 missense probably damaging 1.00
IGL02741:Arhgap20 APN 9 51848645 missense probably benign 0.17
IGL02792:Arhgap20 APN 9 51849918 missense possibly damaging 0.89
IGL03166:Arhgap20 APN 9 51849777 missense possibly damaging 0.63
P0047:Arhgap20 UTSW 9 51849236 missense probably damaging 1.00
R0115:Arhgap20 UTSW 9 51838972 missense probably damaging 1.00
R0121:Arhgap20 UTSW 9 51838951 missense possibly damaging 0.91
R0539:Arhgap20 UTSW 9 51850155 missense probably benign 0.01
R0541:Arhgap20 UTSW 9 51849663 missense probably damaging 1.00
R0551:Arhgap20 UTSW 9 51825825 splice site probably benign
R0570:Arhgap20 UTSW 9 51840451 missense possibly damaging 0.56
R0630:Arhgap20 UTSW 9 51849384 missense probably damaging 0.98
R0931:Arhgap20 UTSW 9 51816741 missense probably benign 0.30
R0992:Arhgap20 UTSW 9 51816786 missense probably damaging 0.96
R1052:Arhgap20 UTSW 9 51846270 missense probably damaging 0.98
R1779:Arhgap20 UTSW 9 51849915 missense probably benign
R1839:Arhgap20 UTSW 9 51849326 missense probably damaging 0.99
R1942:Arhgap20 UTSW 9 51831698 missense probably benign 0.43
R3896:Arhgap20 UTSW 9 51816837 missense probably damaging 0.96
R4109:Arhgap20 UTSW 9 51816685 missense possibly damaging 0.60
R4166:Arhgap20 UTSW 9 51826835 critical splice acceptor site probably null
R4631:Arhgap20 UTSW 9 51840353 intron probably benign
R4692:Arhgap20 UTSW 9 51785788 missense probably damaging 1.00
R5273:Arhgap20 UTSW 9 51848616 missense probably damaging 1.00
R5505:Arhgap20 UTSW 9 51838948 missense probably damaging 0.98
R5743:Arhgap20 UTSW 9 51816727 missense probably benign 0.17
R5847:Arhgap20 UTSW 9 51824976 intron probably benign
R6006:Arhgap20 UTSW 9 51850126 missense probably benign
R6112:Arhgap20 UTSW 9 51829384 missense probably damaging 1.00
R6355:Arhgap20 UTSW 9 51843720 missense probably damaging 1.00
R6576:Arhgap20 UTSW 9 51849278 missense probably benign 0.03
R6801:Arhgap20 UTSW 9 51848592 missense probably damaging 1.00
R7130:Arhgap20 UTSW 9 51849747 missense probably damaging 0.98
R7318:Arhgap20 UTSW 9 51840502 missense probably benign
R7347:Arhgap20 UTSW 9 51849035 missense probably benign 0.07
R7500:Arhgap20 UTSW 9 51840502 missense probably benign
R7598:Arhgap20 UTSW 9 51849790 missense possibly damaging 0.95
R7677:Arhgap20 UTSW 9 51840398 missense probably damaging 0.97
R7725:Arhgap20 UTSW 9 51831750 missense possibly damaging 0.80
R8086:Arhgap20 UTSW 9 51849263 missense probably benign 0.00
R8122:Arhgap20 UTSW 9 51849993 missense probably damaging 0.99
R8125:Arhgap20 UTSW 9 51826909 missense probably damaging 0.99
R8196:Arhgap20 UTSW 9 51848977 missense possibly damaging 0.94
Z1177:Arhgap20 UTSW 9 51824924 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTGGCATCTTACAGCCAC -3'
(R):5'- TGAATAGCTTGCCCTTGGGC -3'

Sequencing Primer
(F):5'- ATCTTACAGCCACGGGTCC -3'
(R):5'- TCTTGGGGGCAAAACCTTCTCAG -3'
Posted On2014-10-30