Incidental Mutation 'R2292:Pccb'
ID245044
Institutional Source Beutler Lab
Gene Symbol Pccb
Ensembl Gene ENSMUSG00000032527
Gene Namepropionyl Coenzyme A carboxylase, beta polypeptide
Synonyms
MMRRC Submission 040291-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2292 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location100982032-101034898 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100994632 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 266 (E266G)
Ref Sequence ENSEMBL: ENSMUSP00000118006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035116] [ENSMUST00000142676] [ENSMUST00000149322]
Predicted Effect probably benign
Transcript: ENSMUST00000035116
AA Change: E303G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035116
Gene: ENSMUSG00000032527
AA Change: E303G

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Carboxyl_trans 59 539 6.2e-197 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142676
SMART Domains Protein: ENSMUSP00000123421
Gene: ENSMUSG00000032527

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Carboxyl_trans 52 256 3.2e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149322
AA Change: E266G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118006
Gene: ENSMUSG00000032527
AA Change: E266G

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Carboxyl_trans 59 187 2.3e-45 PFAM
Pfam:Carboxyl_trans 183 502 2.7e-127 PFAM
Meta Mutation Damage Score 0.1742 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the propionyl-CoA carboxylase (PCC) enzyme, which is involved in the catabolism of propionyl-CoA. PCC is a mitochondrial enzyme that probably acts as a dodecamer of six alpha subunits and six beta subunits. This gene encodes the beta subunit of PCC. Defects in this gene are a cause of propionic acidemia type II (PA-2). Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,732,139 I370T probably benign Het
A2m A G 6: 121,673,559 T1209A possibly damaging Het
Als2 T C 1: 59,187,385 Q920R probably damaging Het
Arhgap20 T A 9: 51,849,443 Y829N possibly damaging Het
Arhgap35 A T 7: 16,563,551 F530I probably damaging Het
Arid4a G T 12: 71,061,541 G40V probably damaging Het
Ascc2 T C 11: 4,679,352 probably benign Het
Cacna1b C T 2: 24,606,620 V2312I probably benign Het
Dctn6 T C 8: 34,092,525 T159A probably benign Het
Ddx55 G T 5: 124,568,077 A522S probably benign Het
Dnah6 G A 6: 73,021,109 T4110I probably damaging Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Dym A G 18: 75,199,212 T504A possibly damaging Het
E130308A19Rik T C 4: 59,690,579 Y138H probably damaging Het
Fgd4 A T 16: 16,436,000 C568S possibly damaging Het
Fkbp4 A C 6: 128,436,662 V6G probably damaging Het
Flg2 A T 3: 93,220,677 S2299C unknown Het
Gdf2 A T 14: 33,945,188 N289I possibly damaging Het
Gm13023 T C 4: 143,793,876 I66T probably benign Het
Gpr182 A G 10: 127,750,182 I300T possibly damaging Het
Iqcg A G 16: 33,049,883 V80A probably benign Het
Letm1 A AG 5: 33,769,515 probably null Het
Lyst T G 13: 13,740,495 F3258C probably damaging Het
Map3k12 T C 15: 102,500,139 E870G probably damaging Het
Mphosph10 G A 7: 64,385,771 P384L probably damaging Het
Ncoa4 T G 14: 32,173,456 L179R probably damaging Het
Nlrp1c-ps A G 11: 71,246,362 noncoding transcript Het
Nwd2 A T 5: 63,805,574 M834L probably benign Het
Olfr1361 A G 13: 21,658,831 M164T probably damaging Het
Olfr517 A T 7: 108,869,016 M46K probably benign Het
Pcdhb2 T A 18: 37,297,244 probably null Het
Prdm13 A C 4: 21,683,914 I119S unknown Het
Tchh A G 3: 93,442,382 Y18C probably damaging Het
Tmem192 T C 8: 64,959,346 V59A probably damaging Het
Trak2 A T 1: 58,935,757 F92Y probably damaging Het
Trappc11 C T 8: 47,505,736 G40D probably damaging Het
Ttc23 A T 7: 67,669,787 I132F probably benign Het
Ttc9b A G 7: 27,655,980 D225G probably benign Het
Ubr3 G T 2: 69,897,260 probably benign Het
Vmn2r75 A C 7: 86,148,936 C556W probably damaging Het
Zbtb41 T C 1: 139,440,359 V595A probably damaging Het
Other mutations in Pccb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00939:Pccb APN 9 100985869 missense probably damaging 1.00
IGL02101:Pccb APN 9 100987841 missense possibly damaging 0.53
IGL02149:Pccb APN 9 100985190 missense probably damaging 1.00
IGL02938:Pccb APN 9 100984396 missense probably benign 0.35
PIT4402001:Pccb UTSW 9 100995592 missense probably benign 0.01
R0446:Pccb UTSW 9 100982797 missense probably damaging 1.00
R2128:Pccb UTSW 9 100985831 missense probably damaging 1.00
R3056:Pccb UTSW 9 101030197 missense probably damaging 1.00
R4574:Pccb UTSW 9 100985199 missense probably damaging 1.00
R4600:Pccb UTSW 9 101034779 missense probably benign
R5087:Pccb UTSW 9 100985243 intron probably benign
R5219:Pccb UTSW 9 100985209 nonsense probably null
R5586:Pccb UTSW 9 100985803 missense possibly damaging 0.87
R5724:Pccb UTSW 9 100987847 missense probably benign 0.02
R6813:Pccb UTSW 9 101023215 missense probably damaging 1.00
R6982:Pccb UTSW 9 101023296 intron probably null
R7253:Pccb UTSW 9 101031913 missense probably benign 0.01
R7535:Pccb UTSW 9 100994562 splice site probably null
R7795:Pccb UTSW 9 100999263 missense probably damaging 1.00
R7822:Pccb UTSW 9 101027084 missense probably damaging 1.00
R8298:Pccb UTSW 9 100985832 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCAAACGTTGAGACCAAG -3'
(R):5'- CCATTCTGGAAGGGCAAAGG -3'

Sequencing Primer
(F):5'- ACGTTGAGACCAAGCTGAAC -3'
(R):5'- TTCTGGAAGGGCAAAGGCAAAC -3'
Posted On2014-10-30