Incidental Mutation 'R2292:Gpr182'
ID245045
Institutional Source Beutler Lab
Gene Symbol Gpr182
Ensembl Gene ENSMUSG00000058396
Gene NameG protein-coupled receptor 182
SynonymsG10-D, NOW, Gpcr22, Admr, Gpcr17, AM-R
MMRRC Submission 040291-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2292 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location127747276-127751732 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127750182 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 300 (I300T)
Ref Sequence ENSEMBL: ENSMUSP00000100882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054287] [ENSMUST00000079692]
Predicted Effect probably benign
Transcript: ENSMUST00000054287
SMART Domains Protein: ENSMUSP00000052717
Gene: ENSMUSG00000044617

DomainStartEndE-ValueType
BTB 30 126 9.15e-24 SMART
low complexity region 197 206 N/A INTRINSIC
low complexity region 213 229 N/A INTRINSIC
ZnF_C2H2 372 394 6.4e0 SMART
ZnF_C2H2 400 420 3.21e1 SMART
ZnF_C2H2 451 474 9.31e1 SMART
ZnF_C2H2 480 502 6.92e0 SMART
ZnF_C2H2 508 530 1.79e-2 SMART
ZnF_C2H2 538 560 1.18e-2 SMART
ZnF_C2H2 605 627 2.57e-3 SMART
ZnF_C2H2 633 655 3.78e-1 SMART
ZnF_C2H2 661 683 2.49e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000079692
AA Change: I300T

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000100882
Gene: ENSMUSG00000058396
AA Change: I300T

DomainStartEndE-ValueType
Pfam:7tm_1 66 316 1.2e-40 PFAM
low complexity region 340 352 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adrenomedullin is a potent vasodilator peptide that exerts major effects on cardiovascular function. This gene encodes a seven-transmembrane protein that belongs to the family 1 of G-protein coupled receptors. Studies of the rat counterpart suggest that the encoded protein may function as a receptor for adrenomedullin. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,732,139 I370T probably benign Het
A2m A G 6: 121,673,559 T1209A possibly damaging Het
Als2 T C 1: 59,187,385 Q920R probably damaging Het
Arhgap20 T A 9: 51,849,443 Y829N possibly damaging Het
Arhgap35 A T 7: 16,563,551 F530I probably damaging Het
Arid4a G T 12: 71,061,541 G40V probably damaging Het
Ascc2 T C 11: 4,679,352 probably benign Het
Cacna1b C T 2: 24,606,620 V2312I probably benign Het
Dctn6 T C 8: 34,092,525 T159A probably benign Het
Ddx55 G T 5: 124,568,077 A522S probably benign Het
Dnah6 G A 6: 73,021,109 T4110I probably damaging Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Dym A G 18: 75,199,212 T504A possibly damaging Het
E130308A19Rik T C 4: 59,690,579 Y138H probably damaging Het
Fgd4 A T 16: 16,436,000 C568S possibly damaging Het
Fkbp4 A C 6: 128,436,662 V6G probably damaging Het
Flg2 A T 3: 93,220,677 S2299C unknown Het
Gdf2 A T 14: 33,945,188 N289I possibly damaging Het
Gm13023 T C 4: 143,793,876 I66T probably benign Het
Iqcg A G 16: 33,049,883 V80A probably benign Het
Letm1 A AG 5: 33,769,515 probably null Het
Lyst T G 13: 13,740,495 F3258C probably damaging Het
Map3k12 T C 15: 102,500,139 E870G probably damaging Het
Mphosph10 G A 7: 64,385,771 P384L probably damaging Het
Ncoa4 T G 14: 32,173,456 L179R probably damaging Het
Nlrp1c-ps A G 11: 71,246,362 noncoding transcript Het
Nwd2 A T 5: 63,805,574 M834L probably benign Het
Olfr1361 A G 13: 21,658,831 M164T probably damaging Het
Olfr517 A T 7: 108,869,016 M46K probably benign Het
Pccb T C 9: 100,994,632 E266G probably benign Het
Pcdhb2 T A 18: 37,297,244 probably null Het
Prdm13 A C 4: 21,683,914 I119S unknown Het
Tchh A G 3: 93,442,382 Y18C probably damaging Het
Tmem192 T C 8: 64,959,346 V59A probably damaging Het
Trak2 A T 1: 58,935,757 F92Y probably damaging Het
Trappc11 C T 8: 47,505,736 G40D probably damaging Het
Ttc23 A T 7: 67,669,787 I132F probably benign Het
Ttc9b A G 7: 27,655,980 D225G probably benign Het
Ubr3 G T 2: 69,897,260 probably benign Het
Vmn2r75 A C 7: 86,148,936 C556W probably damaging Het
Zbtb41 T C 1: 139,440,359 V595A probably damaging Het
Other mutations in Gpr182
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Gpr182 APN 10 127750690 missense probably benign 0.09
IGL00983:Gpr182 APN 10 127750788 missense possibly damaging 0.89
IGL01337:Gpr182 APN 10 127750786 missense possibly damaging 0.95
IGL01810:Gpr182 APN 10 127750864 missense probably damaging 1.00
R0449:Gpr182 UTSW 10 127750696 missense probably damaging 1.00
R0554:Gpr182 UTSW 10 127751071 missense probably benign 0.00
R2229:Gpr182 UTSW 10 127750141 missense possibly damaging 0.91
R2349:Gpr182 UTSW 10 127750937 missense probably damaging 1.00
R2445:Gpr182 UTSW 10 127750627 missense probably benign 0.01
R5977:Gpr182 UTSW 10 127750879 missense possibly damaging 0.79
R6290:Gpr182 UTSW 10 127751024 missense probably benign 0.00
R6415:Gpr182 UTSW 10 127750506 missense possibly damaging 0.88
R8014:Gpr182 UTSW 10 127751005 missense possibly damaging 0.59
R8093:Gpr182 UTSW 10 127750914 missense probably damaging 1.00
R8333:Gpr182 UTSW 10 127749921 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AGGCTGCCCTCTTTGGTAATG -3'
(R):5'- TGTTCAATATCCTGACAGCCTG -3'

Sequencing Primer
(F):5'- CTGCCCTCTTTGGTAATGATGATG -3'
(R):5'- CCTGTTGATGTGGGCTTAC -3'
Posted On2014-10-30