Incidental Mutation 'R2292:Ascc2'
ID245046
Institutional Source Beutler Lab
Gene Symbol Ascc2
Ensembl Gene ENSMUSG00000020412
Gene Nameactivating signal cointegrator 1 complex subunit 2
Synonyms1700011I11Rik, ASC1p100, 2610034L15Rik
MMRRC Submission 040291-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2292 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location4637747-4685699 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 4679352 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070257] [ENSMUST00000109930]
Predicted Effect probably benign
Transcript: ENSMUST00000070257
SMART Domains Protein: ENSMUSP00000063272
Gene: ENSMUSG00000020412

DomainStartEndE-ValueType
CUE 465 507 7.59e-11 SMART
low complexity region 599 614 N/A INTRINSIC
low complexity region 648 663 N/A INTRINSIC
low complexity region 718 735 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109930
SMART Domains Protein: ENSMUSP00000105556
Gene: ENSMUSG00000020412

DomainStartEndE-ValueType
CUE 465 507 7.59e-11 SMART
low complexity region 559 574 N/A INTRINSIC
low complexity region 608 623 N/A INTRINSIC
low complexity region 678 695 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,732,139 I370T probably benign Het
A2m A G 6: 121,673,559 T1209A possibly damaging Het
Als2 T C 1: 59,187,385 Q920R probably damaging Het
Arhgap20 T A 9: 51,849,443 Y829N possibly damaging Het
Arhgap35 A T 7: 16,563,551 F530I probably damaging Het
Arid4a G T 12: 71,061,541 G40V probably damaging Het
Cacna1b C T 2: 24,606,620 V2312I probably benign Het
Dctn6 T C 8: 34,092,525 T159A probably benign Het
Ddx55 G T 5: 124,568,077 A522S probably benign Het
Dnah6 G A 6: 73,021,109 T4110I probably damaging Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Dym A G 18: 75,199,212 T504A possibly damaging Het
E130308A19Rik T C 4: 59,690,579 Y138H probably damaging Het
Fgd4 A T 16: 16,436,000 C568S possibly damaging Het
Fkbp4 A C 6: 128,436,662 V6G probably damaging Het
Flg2 A T 3: 93,220,677 S2299C unknown Het
Gdf2 A T 14: 33,945,188 N289I possibly damaging Het
Gm13023 T C 4: 143,793,876 I66T probably benign Het
Gpr182 A G 10: 127,750,182 I300T possibly damaging Het
Iqcg A G 16: 33,049,883 V80A probably benign Het
Letm1 A AG 5: 33,769,515 probably null Het
Lyst T G 13: 13,740,495 F3258C probably damaging Het
Map3k12 T C 15: 102,500,139 E870G probably damaging Het
Mphosph10 G A 7: 64,385,771 P384L probably damaging Het
Ncoa4 T G 14: 32,173,456 L179R probably damaging Het
Nlrp1c-ps A G 11: 71,246,362 noncoding transcript Het
Nwd2 A T 5: 63,805,574 M834L probably benign Het
Olfr1361 A G 13: 21,658,831 M164T probably damaging Het
Olfr517 A T 7: 108,869,016 M46K probably benign Het
Pccb T C 9: 100,994,632 E266G probably benign Het
Pcdhb2 T A 18: 37,297,244 probably null Het
Prdm13 A C 4: 21,683,914 I119S unknown Het
Tchh A G 3: 93,442,382 Y18C probably damaging Het
Tmem192 T C 8: 64,959,346 V59A probably damaging Het
Trak2 A T 1: 58,935,757 F92Y probably damaging Het
Trappc11 C T 8: 47,505,736 G40D probably damaging Het
Ttc23 A T 7: 67,669,787 I132F probably benign Het
Ttc9b A G 7: 27,655,980 D225G probably benign Het
Ubr3 G T 2: 69,897,260 probably benign Het
Vmn2r75 A C 7: 86,148,936 C556W probably damaging Het
Zbtb41 T C 1: 139,440,359 V595A probably damaging Het
Other mutations in Ascc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02749:Ascc2 APN 11 4640481 critical splice donor site probably null
R0485:Ascc2 UTSW 11 4672302 missense probably benign 0.01
R0632:Ascc2 UTSW 11 4649855 missense probably damaging 1.00
R0690:Ascc2 UTSW 11 4682933 missense probably damaging 1.00
R0942:Ascc2 UTSW 11 4668380 missense probably benign 0.31
R1893:Ascc2 UTSW 11 4672305 missense probably benign 0.01
R1991:Ascc2 UTSW 11 4679257 missense probably benign
R2062:Ascc2 UTSW 11 4681496 missense probably benign
R2063:Ascc2 UTSW 11 4681496 missense probably benign
R2065:Ascc2 UTSW 11 4681496 missense probably benign
R2067:Ascc2 UTSW 11 4681496 missense probably benign
R2068:Ascc2 UTSW 11 4681496 missense probably benign
R3076:Ascc2 UTSW 11 4672446 missense probably damaging 1.00
R4436:Ascc2 UTSW 11 4656305 missense probably damaging 1.00
R4783:Ascc2 UTSW 11 4646653 missense probably benign 0.01
R5211:Ascc2 UTSW 11 4673399 missense possibly damaging 0.95
R5395:Ascc2 UTSW 11 4659273 missense possibly damaging 0.92
R5859:Ascc2 UTSW 11 4658284 missense probably benign 0.11
R5917:Ascc2 UTSW 11 4681506 missense probably benign 0.03
R7569:Ascc2 UTSW 11 4679506 missense probably damaging 1.00
R7875:Ascc2 UTSW 11 4668389 missense probably benign 0.00
X0011:Ascc2 UTSW 11 4658297 missense probably benign
Z1088:Ascc2 UTSW 11 4646656 missense probably benign 0.03
Z1176:Ascc2 UTSW 11 4646653 missense probably benign 0.01
Z1176:Ascc2 UTSW 11 4672487 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAAGCGAACTCAGCCTCTCTC -3'
(R):5'- ATGAGCTCGTCATCAGAGTCTG -3'

Sequencing Primer
(F):5'- GAACTCAGCCTCTCTCTGGGC -3'
(R):5'- CATCAGAGTCTGCATCGTTGGC -3'
Posted On2014-10-30